Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3990  (registered. 2012)
Contig Information
Length 853 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_OKCS Seed DPA5 1
Wh_SHDr Shoot grown with dessication 1
Wh_VHS Shoot with heat shock treatment 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|52548238|gb|AAU82106.1|| 20S proteasome beta 4 subunit [Triticum aestivum]
Score 419
Evalue 2.00E-115
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3990
TTCGATAGCAAGAAACAGTGAAACATATAACCATGAAATAGGGGTCATAAACAGACTAGTCCACATCTGGGAGAATTTGCAACACAGTTCTCGAACCGAA
ACGTATTGCGATTACATAGTGACAGTACTTGGAAACAATTAACAGAAAGGGTTCAGCCTCCAGCCAGCCAAATGACCACCGACAGCGCCAATCACCTCAG
GCAGTTGTTGCTATTGTTGCGGTTGCGGTTGCGACTGCAGGACTGTCACCTCCTATCTCACGCCTAGCATAGTCCCTGGCGCCATCCTTGTCCACGATCT
TGATGGCGAAATTCTGAGGCGCGACGACCAGCCGGAGTCTGATCTCCTTGATGCACTTGTCAACAAGGTCTACCGCTTCCTCGACAGTCATGTCAGGGCG
GTACAACTTGTCCATCAGCGACAAACAGAAGTACGACCCGTACCCGAATGCTCCCTTGTCAATTTTGTGGAGCGTTGCGATGTAGTCAATGTAGTACATC
GATGCACCAGCATCTTTATCAAACCCTGCAAGTATGATGTTTACAGAGTAGGGATTCTTGCGGAGGGCGGTGGCGAGCTCGCCGCGGGTGAAGTTGGCGG
TGGCGGCGGTGCTGAGCGGCATGTTGTTGCGGAACTGGTAGAGGTGGAGGTTCTTCTGGATGAACTCGGTGAACTGCACGCGGTCGCCGGGCTCCCCGGA
GGCGCCCATGAGCTTGTGGGAGTCGAGGAGCATGATCTTGTCCTCGTCCGTCTTGTGGACGAGGATGCTCTGCACGGCGGACGTGTCCGCCGCCACCACC
GCGAAGTCGCTGCCCACCACGCCGATGACGCACTCCATCGCCGGCGACGCCGC
page-top