Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2716  (registered. 2002)
Contig Information
Length 835 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_025748 [Oryza sativa (japonica cultivar-group)]
Score 735
Evalue 6.35309e-76
Total Hit Count 76
Registered year 2002
Contig Sequence     [ Download ]
>Contig2716
gaccttgcgtccattgatggtgatgatgacgaggcttgcttttttgatatgggcgtgtatgaagagggtgaaactggcaatcgacttgcattgtgggaag
attttgaattaaggggattttcccccttggtgcctgcacatattatcttggatttctcaagcaagcacacatttggaagtgatggtagcaccaaggagaa
gaaagcacgggcacaacgGATACTTTCTGCAGGGAAGGCTCTACTCAATTTTgtccagATTGatcaacTGAGAATATATTTTGACCCATCTTCAAGAAAG
TTTGTTGTGGCCAAGGAGCCTCCTGTTTTTGAAGCTGCCACCTCTACTCATAGATCTCGCAATGCACCTGAAACAAATGCTGTTGAGCTGGAACATgaaa
ttgGTAACAAATTTGATGCAGTGGCAACTAATCTTGGAGCAatacaGTCGGGagtacAGTTGTGTtcagaGGGAGAAGATGATGAAGAAATTGTTTTCAA
ACCTACAGCGtccgaGAAGCTCCCAAAAGTACTTACCGAACTACCCGTTAATGGATATATCcagcctctacaaatgtctactgctgggtggccaacaatt
ggcggaccagttgctattcagagtactgcatctgcatcaggtcctggaaactgtaatgttaacgagtcacttcccatgtcttctggtggttgggctttca
atggcaggcgagaggctatttctagcaatgtttcaatgtcgacaacttacgaatttgtgcagcctgttgagatggctacttccagctgggcaagtaatgg
tgcaccacttgttggccctctgaacacaatgccta
page-top