Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3985  (registered. 2012)
Contig Information
Length 1077 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_yd Spikelet at late flowering 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_OKCS Seed DPA5 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VWD Shoot grown with dessication 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|254211611|gb|ACT65562.1|| 70 kDa heat shock protein [Triticum aestivum]
Score 424
Evalue 7.00E-117
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3985
TTTTTTTGGAAAAACATAAAAGAAAAAGAATTATTTCTTCATCAATCAGATGACAAACTCATATCAAGATATGTTCTATAATAAACATCCCAATAGATAA
ACCATGAAACTTAGATGCACCATGATCTGTTTTATAACGGTAACATTATATACGCCATGAAACTTCGTTTATTGCTGACCTAAACATGGCTAGTTTACCT
TTTTAGGGAATATGCTTCTGTTTCGACCAAAATCCTTTTGCATCTTTGCATTACCAGAGGGGTATACTTGATTCAAGATCACTCTAGCAAACGTTGTTGA
TTCCTACCGCTACCAAATTTCATATACTGAATAAACAGCTTGTAGATACATGGAGCCGAGATACAAAAATAACATCCTCAACCCTAGAATGCCACTCAGA
ATATAACTTGACCATCCTTTAATTGCTATCTGTGAAGTCCGCGTCGATAACATCTCCATCATTTGGTCCCTTTCCTGAGCTTGTTGATCCAGCACCAGGC
TCAGTTTCAGCATCAGTAGAGCCAGCACCACCGGCACTAGTTTGGTTGTACATAGCCTGTCCGATCTGCATTACCTCCTGGTTCAAAGCCTCCATGGCAG
TTTTCATGCTCTGTGTCGATCCACCAGCAATGGCATCTTTCAGTTCCTGGAGCTTTACATCAACCTTCTCTTTCACAGGAGCAGGGACCTTGTCCCCAAG
CTCCTTCAGTTGCTTCTCCGTCTGGTACACCACAGAGTCTGCTTGGTTCTTGGTGTCAATAGCATCTCTTTTCTCTTTGTCCTCCTGGGCAAACTTGTCG
GCTTCTTCTACCATTCTCTCGACCTCGTCCTTTGGTAGTGTACTAGCACCAGTGATGGTGATATCCTGCTTCTTTCCAGTACCCTTATCAACAGCTGCTA
CTGACAGAATGCCATTGGCATCAATGTCAAACTTCACTTCAATTTGTGGTACACCACGTGGTGCAGGAGGGATCCCATCCAGTCGGAAGCTTCCAAGAGA
CTTGTTGTCCCTGACAAACTCTCTCTCTCCCTGGAGGACATTAATCTCAACACTTGTCTGTCCATCAGCAGCCGTTG
page-top