Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3974  (registered. 2012)
Contig Information
Length 685 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_OKCS Seed DPA5 4
Wh_VHS Shoot with heat shock treatment 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195604338|gb|ACG23999.1|| early nodulin 93 [Zea mays]
Score 172
Evalue 2.00E-41
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3974
GCACGAGGCACCGTTTCCTTCAATCGGAAGATAGCTATAGGGGAAAAGAAGCCGCCAGGGAGAAGAAACAGAACGGAGCGAGGAGCCATGGCCGCCAGGA
ATTTCTTAGTCCGATCCCCCAAGGAGGAGGAATCCAGCGCTGCCGTCCGAGAGGCTGTCTTGTTGGGAGGGAAGAACGCCGCCATTGCTGGTACTGTGGT
CGCGGTTCCCACGTTGGTTGCTTGCCGTGTCCTTCCTTGGGCTAAGCATAATCTGAACTACACCGCACAAGCACTCATCATATCGGCAGCCTGTATCGCT
GGCTTCTTCATCACCGTAGATAAAACCATCCTACGAAACGCAAGACAGAACACCATTGGGAGGATTGACAAGTCGACTTGATCCAGGACTGTACAGAACC
GAGGCTGATGCGAATCGCGTCAAACTCCCCTCTGTTCCATCTATGGATGGTGATGCACGACCGTACGGCGATTTTCAGTTTCAGGCTTATTTTGTACCTA
ACCTTGCAATGTAAAGACTAAAGAGAGTTGCTGCCTGCTAGGGCAGTGGACCCCGTTTGCTCCCAATTGGAAGTGGAATAAAAGACGGGATGCTAAGTTA
AAACTGTTGTTGTGCTGTCAGTCTACTTCAGTTCTGTTTAGTTAAAACTAATAACTGAACCGAAATTTCATATCCAAAAAAAAAA
page-top