Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3966  (registered. 2012)
Contig Information
Length 936 bp
Clones alternative view 24 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115436430|ref|NP_001042973.1|| Os01g0348600 [Oryza sativa (japonica cultivar-group)]
Score 388
Evalue 4.00E-106
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3966
TTTTTTTTTTCAGAAATTCAGGTTTGGACATTCACCGCTGTTGCGGGACAGATTCGGTGCGTAACAAAAGAATTGACAGAGCATATTTGCAATATTATTT
AAGAATCATTGCGCATATTACATAAAACTCTTCCAAGGGTCCAACCGCAATCAGTTACGGTTTCCTTTGCTTCCCAATATACAGCTCACGTGTTGTTATT
ATTATTCAGCCCCTTCCACTAATCACCACCTTCATCGCGCATTATTACTCGGTGACATAATTTCCTTCAGCTGACAGAAATACCAGACCTACCATCACCT
ATAGCCGGGCCTTGACTTGACTTGCTGCTGGTGCACTCAGAGGAATCCCTTTTGCCGCTCTTTCGGCAAGGTAGGAGCAAGGCTCGAAGAAGCTGCCGTA
CCGCTTCGCCCACTCCGCCAACTTGCCGTGGATGTATTTTGCGCCGATGGAATCCCCCCATAGCATGACCCCTCCCCTGTAAGGTGGGAAACCCATGCCA
AAGATTGAGGCGATGTCAAGATCCGACGCCTTGACCGCAATGCCCTCATCAAGGACACGGCATGCTTCGTTTATGACTGGGAAGAACACCATCTCTACTA
TGTCCTTGTCACTTAGCTTCATCAACTCAGCATCTGGAGTGACTCCTGCCATGCTCCTAGATTTCTGAATATACGTCATAATTTCAGGATCAGGAGTTGC
CTTCCTTTTATCCTCGTACTTGTAAAATCCCTTCCGACTGGCTTCGCCTGATCTTTTGTCTTCCATCATAATAGGGATTAGCATGGACTTGTAGACTCTC
TCTGGGAAATTTTCAAGGTACTGCATACCAGTAGCCACAGCAACACCAAAACCAACAAGATCTGCAAGCCTGAATGGACCCATGGGCATTCCAAATTTGG
TACATGCACGATCAATCTTGTAAACATCCATGCCAT
page-top