Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3955  (registered. 2012)
Contig Information
Length 684 bp
Clones alternative view 28 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_h Spike at heading date 2
Wh_r Root 1
Wh_yd Spikelet at late flowering 4
Wh_EM Dormant seed with water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
WH_SP 5
WH_XA Root 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242051601|ref|XP_002454946.1|| hypothetical protein SORBIDRAFT_03g001950 [Sorghum bicolor]
Score 171
Evalue 6.00E-41
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3955
TTTTTTTTTTGAAAAAGTCAACAAGGTCTGTTCATGTCAATCTTAAACGCAACCGATAAGCTCATCATCTTGATCAAACATCTTGCACGGAGTCGACAGA
ATGGATTTACTGGGTCTGGGTTCATAGATAGACAACAGACGTTACATATGCTCAGTGACCACAACGACAAGCTACATGCATTTCAGCCTGGGTGGAGTTC
AAAGTATCACAGGAATGCTCAACACAGGAACGAGAACGCCAGCCATCCTAGAGAGAGAAGCTTCACTTTCCAGTGTTCATCATCAGAGTTATGTTGTCAC
CTTTCAAGAGTATCCTTCCCAACGATTTCCTGGTGTTCTTCTTAATGTTGATTTCCTCAGCATCCTCGAGAACCAGGTTCATGTACTCATCAAAGCCGAT
GATACGACCCTCGATCCGCATATCCTTCTGCTCGAAAAGCCAGATCTGGATGCGCGCTTTGCTCTGGAGGAACCGGAAGATGAGATTGATGGGCTGGGTC
ATGATACGCTGGACCTTGGTGGACGCCATGGCTGCTGCGCGGCGTGAGCTGCTCCTCCGACTGAAGTGTCTAGAAGCTTCTGGAGGGAAGCGCGTGTGGG
CAGGCGGAGCGGGGAGGTAAAAACCCTAGATACGCCGCAGAGGAAGGGGGAGACGGCAGGGTTTTGTTTTCGCCTCGTGCCGAA
page-top