Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2393  (registered. 2002)
Contig Information
Length 537 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_h Spike at heading date 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0354400 [Oryza sativa (japonica cultivar-group)] >gi|113578837|dbj|BAF17200.1| Os05g0354400 [Oryza sativa (japonica cultivar-group)]
Score 841
Evalue 1.20331e-88
Total Hit Count 440
Registered year 2002
Contig Sequence     [ Download ]
>Contig2393
gcGACGAGTACCAGAAGTGGCGGTGGCAGCCTGATGCCTGCGACCTCCCAAGGTTCGATGCGAAGTTGCTTCTTGAGAAGCTAAGGAACAAAAGAATGAT
GTTTGTGGGGGATTCACTGAACAGGAACCAGTGGGAGTCCATGGTGTGCCTGGTCCAGTCTGTGGCTCCATGGGATAAGAAAAAGCTTGTCAAGAATGGA
TCTCTAAATGTGTTCCGCCTTAATGAGTACAATGCAACGATTGAGTTCTATTGGGCTCCTTTCCTAGTTGAGTCGAACTCAGATGATCCAGACAtccata
gcatcaccgaccgaatgatcacgccaacatcgatcgccaagcatgcagcaaattggataggggtggactatttgatcttcaacacttacatttggtggat
gaacaccccgaagatgaaaattgtgcctgacggatccttcacaaggaaaccagttaagtacgatgaattggatcgtgtggttgcgtaccgacagatcctc
gagacatggtctggatgggtagaagagaatgtagatc
page-top