Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2334  (registered. 2002)
Contig Information
Length 604 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0428900 [Oryza sativa (japonica cultivar-group)] >gi|113564376|dbj|BAF14719.1| Os04g0428900 [Oryza sativa (japonica cultivar-group)] >gi|215692452|dbj|BAG87872.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215708687|dbj|BAG93956.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218194854|gb|EEC77281.1| hypothetical protein OsI_15914 [Oryza sativa Indica Group]
Score 772
Evalue 1.65468e-80
Total Hit Count 142
Registered year 2002
Contig Sequence     [ Download ]
>Contig2334
aatcgcacaatctcagaggccaaaaccctcgccccccaACATCACACCGCCGGCGATCTCCTCCTCCTCCTCCTCCTCCGATGGATCTCTCGGCCGTCCA
CGCCGCGCTCTCTGCCAAGTCCTACTCCGCCATCGCCACACTCTGCGACGACCTCTTCCTCCAGGTTGCGTCCCGGGGCGTCGCCACCGACGACTGGCCT
TACGCCGTTCATCTCCTCGGCCATCTCTATCTCAACGACCTGAACAGCGCGAGGTTTCTGTGGAAAACGGTGCCGCAGGAGGTGAAGGACGCTCATCCGG
AGCTGGGCGCCATCTGGAAGATTGGCCAGTGCCTCTGGAACCGTGACTACGCTGGGGTCTATACTTCCGCACAGGGGTTCGAGTGGGGGCCTGAAATCTC
TGATTTTGTGACCGCCTTCCTAGAAAGCTACAGAAAGAGGATATTCGAGCTGTTGACTTCTGCGTATACCACAATCAGCATTGCAGATGTGGCTCACTTC
ATGGGGATGAGCGAGGAGGATGCTACTAACTATGCcgtgcAAAATGGTTGGAGTTTGGATGTGGCAACCAAGATGCTTACTGTcagaaaacaaaagcccc
agac
page-top