Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3944  (registered. 2012)
Contig Information
Length 974 bp
Clones alternative view 79 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 3
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 2
Wh_r Root 5
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 10
Wh_SHDr Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_CA 1
WH_SP 2
WH_XB Root 5
WH_XD Root, treated at 50 microM Al for 6h 11
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115589740|gb|ABJ15729.1|| cobalamin-independent methionine synthase [Triticum monococcum]
Score 379
Evalue 2.00E-103
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3944
CCACACTTGCACACACACGCTTACATGGCCGCGGCCCAACACTACAATTGCACTGAGTGCCTCGCTGTACGCTTCAGGGTTCAGTTAACTGCTGGACTGA
ACCTGAAGGCGTTACACCAACACAGCCAAGACAAGAACATCCGGAGAAATTTTGTAATTTGAAAACGTAACGTAACAAACTCAAGACTTAGATGATGAAC
AATTCGCCACTCAGTTTACAATACACACCGACAACCGCCTCAAAAACCACCAAATCAAAGGGATGAGCACATGGCGCCGCGCCGCGCCGAGAAACAAACT
AGCCTAACCAACAGGTGGATACAGAGACCCAGATTATTCAAAGTAAACACGGCTATGGTGGCGACATCCTCCTTGCAATTAAAATGGGGGAGCTGCTATA
CGGCTTACTGCGCCTTGGCGAGCTCGGCGCGGATCTGCTTGGCGGCCTCGACCATGTTGGTGAGGGCGGGCTTGACCTCGGCATACTTGCGGGTCTTGAG
ACCGCAGTCGGGGTTCACCCACAGGATGTTGGTGTCGAGCACCGCGAGCATCTTGTTGACACGGTCGGCGATCTCCTCCTTGGACGGGATCCTGGGGGAG
TGGATGTCGTACACGCCCGGGCCAATGCCGGCGCCGTACACCACGCCCTCGCGGAAGACGGAGAGAAGCTTCTCGTCGGACCGCGAGTTCTCGATGGTGA
TCACATCGGCGTCCATGTTGATGATGGACTGGATGATGTCGTTGAAGTTGGAGTAGCACATGTGGGTGTGGATCTGGGTGGTGTCCTGGACACCGCAGTT
GGTGATCCTGAAGGAGTGCACGGCCCAGTCCAAGTAGAAAGCATGCTCCGACTTGCGGAGTGGCAGACCCTCTCTCAAAGCAGCCTCATCGATTTGGATA
ACCTGAATACCACCAGCCTCAAGGTCCTCGACCTCCTTCTTGATTGCAAGAGCAATCTGGTAGCAAGTCTCAAA
page-top