Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3941  (registered. 2012)
Contig Information
Length 948 bp
Clones alternative view 76 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 4
Wh_h Spike at heading date 3
Wh_r Root 2
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 7
Wh_EMI Dormant seed with water absorption after breaking 10
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 9
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115442401|ref|NP_001045480.1|| Os01g0962600 [Oryza sativa (japonica cultivar-group)]
Score 334
Evalue 8.00E-90
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3941
ACCCAATCTAGGAGGCATGCACACATTCCACNTGTCAAAAGAAAGTGAAACGTAACTTCTTGGAACCAGTTTTTTTTTTGGACAGAATTTTTTTTTAAAT
AGCAAGTTGACCATCTTTAGATTGTGAGTCGATCAACAGCTGTCTTAATATCAAAGAGCTCATTCTAACACAAACGAACCCATAAACCATGGTCTTAAGC
TACAATCCCGATAAACAAAATCATCACAGTGTTCGCAGAATTCAAACATCAACAGAGAGGACAGCACCCCACGCACGCATTGGATCTGAAGACCTGTTGG
GTGCTCCCACTTGCTGAAGAGTCGCTTCTTCACTCCATGGTAGCTCCAGAACCGAAAGTGCCGCCGCCGCCTCCACGGCCAAAGGGCCTGGCAGCACCAC
CAGCACCCCTGAAAGCTGGCTGGTACTCAGCAGGAGCTCCACCCTTCTCACCAGCAAAATCACCTGGAGCACCACGTGGGCCTCCTCTGTAACCATCCCT
GTCACCATACCTGGGCCTGTCACCCTCAAAACGAGGAGGACCCCTGGGGCGGTCACCCGGTGGGCCAGAGCCGAAGGGGCGGGACGGGGGCTTGGCGGAC
TTCTTGAGGGTGTTGGGCACGATCTCAGACGGCAGGTTGAGGAAGGTGCGGAGGAACTCAATGCCGTCGTTGGTCAGGTACCAGTAGTAGTGCTGCCACG
AGAAGGTCTCCCTGACGTACTCCTTGGACTTGAAGCTCTGCATGAGCTTGATGACCTCGAGGTTCGAGGCATCGACCTGGGGGTGCTTGGCCAGGTTGTA
GTCCTTCTTGGCGTACAAGACTCCCTCCTGGAAGAGGTACTTGCAGATCTCGCGGCGGTTCTTCTTGGAGATGATCATGGTGACGGGCGCCGGGGGCGGA
GGCGGGGACGGAGACGGCGGCGCCGCGGCGTGCAGGCGAACGGGAGGC
page-top