Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3938  (registered. 2012)
Contig Information
Length 731 bp
Clones alternative view 39 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_DPA20 Seed DPA20 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 6
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 13
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_SP 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|94315719|gb|ABF14722.1|| non-specific lipid transfer protein 1 precursor [Triticum aestivum]
Score 221
Evalue 6.00E-56
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3938
TTGCATATATCAAAAGTGCTGAATAACATGCTTTTTTTTTTAGAGCTGATCAGCTGAGTATACAATCCATATATCAAAATTACACATGGTACAAAGTACA
GCATACTCGGGGAGTGGAGGAACAACCAAACTCGGGCCGGCCATGCAGAGCTGCTTGACGTACGTACTCCTCTCTCTCTCACGCAGTGAGATAATATGAG
AGCATTTATTCATATATATATGTGTGTGTGCGTGTGTGTGACCTCAACATACTAAGCGTAGATCCAGCAACGATGGTGCAGGGGACGATGGCAACAGCGA
TGGCAGCAAGTGCTCGATCAGCGAATCTTAGAGCAGTCGACCGAAGAGCTGATGGTGTAGGGAACGCTAACGCCGCACTTTGTGGGGATGCCCGCGGCCT
TGCCAGCGTTGAGCCCAGCAGCAGCGCTCTTGATACACTTGCACGCCGCTTGCTTGTCAGCGGTGCTCCGGGCTGAGCTGGCTAGACTCCTAACGCCGCT
GCAGCAGGCCGCAGACGGGTTGGCGCCGTTGCCGCGTGCATAGGAGATGCAGGGGCTCAAGGCAGAGCTCACCTGACCGCACGATACGGCCGCCTCCGTG
GCTGCGAGGAGCATAGCGGCCACCACGGCGACGAGCACGACCTGAGCAACAGCAGAATGGGCCATCACGATCAAGCTAGCTAGCGCTAGTAGTGGTGGTG
AGCTCAGGCAGAGATGATGAAATAGCTAGAT
page-top