Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3915  (registered. 2012)
Contig Information
Length 1296 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 1
Wh_SHC Shoot grown with cold treatment 1
Wh_VABA Shoot with ABA treatment 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|213959182|gb|ACJ54925.1|| TCP-1/cpn60 chaperonin [Oryza sativa Japonica Group]
Score 692
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3915
GCCGAGCTTACCAGCTTCTAGGGCTACCTTCTTCCCTTCATCTCCACTCCCGCACACACGCCGGCCACCACTAGGGTTTTACCGATCCGCCTCACCCCAC
GCCGGCCACCACCAGATCCCCTCCGCCCTACGCTCTCACCGCTGCCGACGATGGTGGGATACGGGATCCAGTCGATGCTCAAGGATGGGCACAAGCATCT
CTCGGGCCTCGACGAGGCCGTCCTGAAGAACATCGGCGCCGGCCGCGAGCTCTCCGCCATCACCCGAACCTCCCTTGGCCCCAACGGAATGAATAAGATG
GTCATTAATCATCTAGACAAGCTCTTTATCACGAATGATGCTGCAACAATCGTGAACGAGCTTGAGGTCCAGCACCCTGCTGCTAAGCTCCTGGTGCTCG
CTGCCAGAGCGCAACAGGAGGAGATCGGAGATGGAGCTAACCTCACCATATCTTTCGCTGGTGAACTGCTCGAGAAGGCTGAGGAGCTCATCAGGATGGG
ACTGCATCCAAGCGAGATCATCATTGGGTACACCAAGGCCATTAATAAGACGCTTGAGATTTTGGATGATCTAGTTGAGAAAGGCTCTGAAAATATGGAT
GTCAGGAACAGGGAGGAGGTCGTGTTGAGGATGAAATCTGCTGTTGCAAGCAAGCAATTTGGCCAGGAGGATGTGCTGTGTCCACTTGTCGCTGATGCCT
GTATCCAAGTTTGTCCCAAAAATCCGGCAAACTTTAATGTTGACAATGTTAGAGTGGCAAAGCTGGTTGGAGGCGGCCTTCACAATTCTTCTGTAGTTCG
TGGGATGGTTCTGAAAAATGATGCTGTTGGGAGCATTAAAAAAGTGGAGAAAGTGAAGGTTGCGGTATTTGCTGGTGGTGTTGACACTTCTGCAACTGAA
ACAAAGGGAACTGTTCTTATACATTCTGCTGAGCAGCTTGAAAACTATGCTAAAACTGAGGAAGCAAAGGTGGAGGAGCTTATTAAATCTGTGGCTGATT
CAGGTGCCAAGGTTATTGTCAGTGGAGCAGCAGTTGGCGATATGGCATTGCATTTTTGTGAACGTTACAAGCTAATGGTTCTGAAAGTCAGCTCAAAGTT
TGAGCTTCGAAGATTTTGCCGTACTACTGGGGCTATAGCACTTTTGAAGCTTAGCCGACCAAATGTGGACGNATTAGGATATGCAGACTCTGTTTCAGTG
GAAGNAATTGGCGGTGCTCGAGTGACTGTTGTCAAAAATGAANNNNNNGGAAATTCAGTGGCTACTGTTGTCTTGAGAGGCAGTACAGATAGTATA
page-top