Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3897  (registered. 2012)
Contig Information
Length 748 bp
Clones alternative view 93 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_f Spike at flowering date 2
Wh_r Root 4
Wh_yd Spikelet at late flowering 6
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 4
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 5
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_CA 1
WH_SP 2
WH_XA Root 7
WH_XB Root 10
WH_XC Root, treated at 50 microM Al for 6h 13
WH_XD Root, treated at 50 microM Al for 6h 7
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|219362517|ref|NP_001136755.1|| hypothetical protein LOC100216896 [Zea mays]
Score 296
Evalue 2.00E-78
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3897
TTTTTTTTTTAGCAAAGAAATTTTTTTTTTAGATGGCAACCACTTGATTCAAAGCAGGGAAAAGGGTCATTTTCTAAACATGCAACACAATATCGCTCAA
AATCTATAAATCCACAAGATCTGACTTAACATCATAAACGGAGTAACATCATAAACGGAGTAGTACAGAACAAGTTGCAAGACACAGGATATCGATAGCT
TGGTATTGTTCCATCCTTGAACGAGCATGGAATTACAGCCTCCTTCCTCTTCTACCACCCTTCCGGCGAGTGCTGTCAGTTGGAACCGGGGTAACATCCT
CAATGCGTCCAATCTTCATGCCAGAACGTGCAAGAGCTCTAAGCGCAGCTTGAGCACCAGGACCTGGAGTTTTTGTCTTGTTTCCACCAGTAGCACGGAG
CTTAATGTGCAGAGCAGTAATTCCAAGCTCCTTGCATCTTACAGCAACATCCTGAGATGCAAGCATAGCTGCATAAGGGGATGATTCATCACGATCAGCT
TTCACCTTCATGCCACCGGTGATGCGGACGAGCGTCTCCCTCCCGGACAGATCCGTGACATGGATGAAGGTGTCGTTGAAGGAGGCGAAGATGTGCGCGA
CGCCGAAGACGTGCTCCCCCTCGCGGACGGCGGGGCCGAGCGTCACGTTCTCCTCCTTGGGCTCGCGGGTCTTCTTCCTCCCTGACATGGCGGCGGCGGC
GGCGGCGGCGGCGAGAGGAGGAGGAGGCTAGGGTTTGGAGTGGACGAG
page-top