Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1796  (registered. 2002)
Contig Information
Length 595 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: hypothetical protein [Macaca mulatta]
Score 110
Evalue 0.000932753
Total Hit Count 276
Registered year 2002
Contig Sequence     [ Download ]
>Contig1796
aacgcacggtgccttgggcgactacctcccgcacgcaaaaaaaaacgcacccaccacctccgctctcctcctagggcgacACTGGGGCGCCCCCCAACCC
TAGCCGTCACAGACCCCCACCACAACCACGCCTTCGCCGCCGGTGGCGGCGAAGGcggctcCTCAAAGCAGGGACGCGTCTCCCgtacgAAATCCAAGTC
CGTTCGCGCGAGCTTCTCCGCCCCTCGATCCGATCTTCACCTTCGCTCATGGTGGCCGTCAGCTGGCCTCCCGCCGGCGGCCAACTTGATCTGCGCGGCA
CTCGGCTGCCcgcatGGCCTACCTCCTCCCCATCGCGGCACTCgttggccgccgttgggcctgcttgcggcgcacaggtcgggtcacgcgcgacggctac
atcatcgccggatctgtctttccgtccgactgcgaccccaaccccagcaccctcaatccaccgcccgcttcccccactcccgcttgactccatggggccc
taaggtcgatagcgccgaggaggagtcagagacggcactgggggaaagagcagcgaggccggaggcccagacggcgctcgcgttatgtgtctaac
page-top