Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1795  (registered. 2002)
Contig Information
Length 522 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Aspergillus niger] >gi|134075087|emb|CAK39098.1| unnamed protein product [Aspergillus niger]
Score 78
Evalue 3.33047
Total Hit Count 1
Registered year 2002
Contig Sequence     [ Download ]
>Contig1795
gcacctgctgTCCctcgat*ctCCCTCTCctcttcgtcgaGAAGTCCCTATCTCTCTCCTTTCCATCTCCCTCTCCGGCCGCCGGCGTTGAAACAACAAC
GCCCAGAATCCAAATCATGAGGTCCAGCGGCTGCGCGCTGTGATTGCATCTTTTTTGCGACGCAGGGCTGTAGCTCCGTGGACCAATAACACGGCTGCAT
AGGAGTCGGCTATCCGCCTTTATAGCTCGAGGATCTGAGGAGGCTCTGTGGTCATTTCAACATGCATTATGTATTCCATCTATCTTGAAGTCATCAAGAT
GACTTTCTGTTCATGCTAGTTGGCCTGAGGATTGATTTGTACTCTATCGCCCGAAATGCTTTCCTCGTGAAGTATATCTACTAGTCGCTGCTGCTAAGTT
GATTTTTTCGATTCCTTTTGTCTAAACCTGGTGCACAAaggaaaacaaatgctGTACAAgtctatatgtacttctacttcggttgtcatttatgcacttg
gatgcttcgagtaaaaaaaaaa
page-top