Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1765  (registered. 2002)
Contig Information
Length 554 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative phage-related protein, similar to zonula occudens toxin [Stenotrophomonas maltophilia K279a] >gi|190012341|emb|CAQ45969.1| putative phage-related protein, similar to zonula occudens toxin [Stenotrophomonas maltophilia K279a]
Score 77
Evalue 5.11818
Total Hit Count 8
Registered year 2002
Contig Sequence     [ Download ]
>Contig1765
attcggcacgagggcAGTTACGGCGAACTCGACATAGTCAagg*atGGGAAAGAACCATGGAAATAAGAAAGGGCTCAGGTGGTAAGCACATTGAAAGGA
TCGACGGTTGACAACCCGATCTATCTCAGTGACCATGAAGGTAGAGGCCAGAGGTTAAGAGCCTGTTTGGATTCCTTCCATAAAAAGCAGCCTAAGCCAG
GCACAAACCTTAGGCGTCCGATTTTGGAGGCCTGAGGCTGAGATCTCTGCCTGAGTAAAGACCTGCCTGATAGGCCTCAATCCAAACACCCCCTAAGATT
GTGTAGTGAACCATGCCTTTGTGAGAGGACCAAGACAAAAGTTCAATGCTGCATCGTTTGCTTGCTTCCTTTGCTCGGTTCGAGATCCAGGCCGGGAGTA
GGCTAGGACCAGTGATAAGAACGTCAGGGTGTTGCGTCATGGCTGTATACATGTGTTGAAAGCATTGAGCTTAATTTAGATATGTAGGTGCAATTCCTTT
TCGTGTATAAGAtaatgggtttaTATATAGGctgtccatgatggaagttgaagt
page-top