Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3876  (registered. 2012)
Contig Information
Length 1993 bp
Clones alternative view 142 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 9
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 5
Wh_yd Spikelet at late flowering 5
Wh_DPA20 Seed DPA20 5
Wh_EM Dormant seed with water absorption 7
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 13
Wh_PCDAM Anther at meiosis 12
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 5
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 7
WH_XT Roots, 18 day old plants were grown hydroponically 5
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XA Root 6
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 11
WH_XD Root, treated at 50 microM Al for 6h 6
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23Ž 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125550096|gb|EAY95918.1|| hypothetical protein OsI_17784 [Oryza sativa Indica Group]
Score 594
Evalue 1.00E-167
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3876
GAAGCCGGCGAGGAAGGGCCAGGTGCGGCCCCACTCCCGGCGGAAGAACACCGGCCACGGGTCGAACGCCGAGAAGAACTTCATCTCCGGTGGGTAGCGC
TCCCCAAAATGCAGATCTTCGTCAAGACCCTCACGGGGAAGACCATCACCCTCGAGGTTGAGAGCAGCGATACCATCGACAATGTCAAGGCCAAGATCCA
GGACAAGGAGGGGATCCCGCCGGACCAGCAGCGGCTGATCTTCGCCGGCAAGCAGTTGGAGGACGGCCGCACCCTTGCCGACTACAACATCCAGAAGGAG
TCGACCCTCCATCTCGTCCTCAGGCTCCGCGGAGGCATCATCGAGCCATCCCTGCAGGCTCTTGCCCGCAAGTACAACCAGGAGAAGATGATCTGCCGCA
AATGCTACGCGCGCCTGCACCCAAGGGCTGTCAACTGCCGCAAGAAGAAGTGTGGCCACAGCAACCAGCTGAGGCCCAAGAAGAAGATCAAGAACTAGAG
TGCTACTAGTCAGTTTCATGGACCGGTTGAATCCATTGCTGTGTTAGCGTTTATGCTATTGTCGTCTCGTTGTCGTTGAACCTTATTTTACTTTGCTTTC
AGCCTCCAATCGTTGTGGTGATGATAATTGACAGTATTGGTATATGGTAGCAAACCTATAATTTTGCCGTAAAAAAAAAATTTGTTCTCCTCGTGCCGAA
TTCGGCACGAGGCACAAACGCGGCCGTCGCAGCAGCAGCAGAGAGGAGCAGCAGACACCCAACCGCAGCCGTACGCCGCAGATCCGCCGCCGCGCACGCT
AGGGTTTCGCGCCGAGGAGAGAGGGGGGGCGATGGACGTGGTGAAGGCGGCGCAGCTCTCGGGGCGGACGCTGGAGAAGGTGGTGGTCCACCCGCTGGTG
CTGCTCAGCATCGTCGACCACTACAACCGCGTCGCCCGCGACACCAGGAAGCGCGTCGTCGGCGTGCTCCTCGGCACCTCCTCCCGCGGCGTCGTCGACG
TCACCAACTCCTACGCCGTGCCGTTTGAGGAGGATGACAAGGACCCGAGGATCTGGTTCCTCGACCATAATTACCACGAGTCTATGTTCTCCATGTTCAA
GAGGATCAACGCCAAGGAGCATGTTGTTGGCTGGTACAGCACTGGTCCAAAACTAAAGGAGAACGACTTGGATGTTCATGCATTGTTTACCAACTATGTT
CCTAATCCTGTCCTGGTGATTATTGATGTTCAACCCAAGGAGTTGGGAATACCCACCAAAGCATATTATGCTGTAGAAGAGGTTAAAGAGAATGCTACTC
AGAAAAGTCAGAAGGTGTTCGTCCACGTGCCATCAGAAATTGCGGCCCATGAAGTCGAGGAAATTGGAGTTGAGCACCTTCTGAGGGATGTGAAAGACAC
AACAATAAGCACACTTGCCACAGAGGTCAGCAGCAAGCTTGCAGCCCTGAAGGGACTCGATGCGAGGCTTACGGAGATCCGGGGTTATCTAGATCTTGTA
ATTGAAGGGAAGCTCCCACTGAACCATGAGATTCTGTACCACTTGCAGGATGTGTTTAATCTGCTCCCCAATCTCAACGTAAATGAGCTCATTAAAGCCT
TTGCAGTGAAAACAAATGATATGATGCTGGTCATATACCTGTCTTCTCTTATCCGGAGTGTCATTGCTCTCCACAATTTGATCAACAACAAGATGCTAAA
CAAGGAACATGAGAAGGCCGAGGATTTGAAGCCAGCCGCCGTACCTACTGCAGCAGGGAGCTGAATGTCCTTGTTTGCCTCAAGATGGGGATAGCGATCT
ATGACCCAGCATTGGGGCAAAGAAACTGTGACATGTTAGCATTGTCTCATTTGTACCAAGTGTCTTGACCTTCAATTTACACTTTGATGTTTACTTCATG
TACGATGAGGTCAACGACAAAACCTTACATTCTGTGAGCTCTAGGTCTTTTTGAGGTTTATAATCTAGATCTTATACTGTTTCATCTGCCGCG
page-top