Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3864  (registered. 2012)
Contig Information
Length 1564 bp
Clones alternative view 102 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
Wh_KMP Shoot grown under continuous light 1
Wh_OKCS Seed DPA5 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 11
Wh_VHS Shoot with heat shock treatment 7
Wh_VWD Shoot grown with dessication 5
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 16
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 7
WH_XN Leaves, plant was grown at constant 23Ž 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 2
WH_XE Seedling, infected with leaf rust 4
WH_XF Seedling, infected with leaf rust 8
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 9
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 7
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115470621|ref|NP_001058909.1|| Os07g0152900 [Oryza sativa (japonica cultivar-group)]
Score 678
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3864
CCCTCTCTTCCCACCTCCAATTGCTCATCTCATCCATACAGCCCCTCATCTCTCTCAACTGCTCAATTATTCTCCGTTGTATTGTTTGTCTGCATGCACA
GAAACCTTGAGGACTCGCCGCCTCATCTCTTATATTGCATCCATCCCCTTCCCCACCACAACCCCTAGTTCCTTCCTTCCCTTCCCCTCAGCCTTGAGGG
GACAGTCAGCCACAGCCTCCTCATACAAGAAAAATGGAGATCACCAATGTCACAGAGTACCAGGCCATCGCCAAGCAGAAGCTTCCCAAGATGATCTATG
ACTACTATGCCTCCGGTGCCGAGGACGAGTGGACGCTCCAGGAGAACAGGGAGGCCTTTGCCAGGATCCTGTTCCGCCCGCGCATTCTGATCGATGTATC
CAAAATCGACATGACAACAACTATCCTGGGATTCAAGCTCTCAATGCCCATCATGATTTCCCCCACTGCCATGCAGAAGATGGCTCACCCAGATGGAGAG
TATGCGACTGCCCGCGCAGCATCAGCAGCAGGCACTATAATGACATTGTCGTCCTGGGCTACTTCAAGTGTTGAGGAGGTTGCCTCAACCGGACCAGGGA
TCCGTTTCTTCCAACTCTATGTCTACAAAGACAGGAAGGTGGTCGAGCAGCTTGTGAGGAGAGCGGAAAAGGCTGGATTCAAGGCGATAGCGCTCACCGT
GGACACCCCGCGACTTGGCCGCAGGGAAGCTGATATCAAGAACAGATTTGTTTTGCCACCAAATTTGACACTCAAGAACTTTGAAGGTTTGGACCTCGGG
AAAATGGACCAGGCTAACGATTCAGGACTAGCTTCATATGTCGCCGGCCAAATCGACCGCACACTGAGCTGGAAGGATGTGAAGTGGCTGCAGTCCATCA
CCACGATGCCGATCCTGGTGAAAGGAGTGATCACCGCAGAGGACAGCAGGCTCGCCGTCGAGAACGGCGCGGCCGGAATCATCGTGTCCAACCACGGCGC
CCGGCAACTGGACTACGTCCCGGCGACCATCAGCGCCCTGGAAGAGGTCGTGAAGGGTGCTGGCGGGCAGATCCCCGTCTTCCTGGACGGCGGTGTGCGC
CGCGGCACCGACGTCTTCAAGGCGCTCGCTCTCGGCGCCGCCGGCGTCTTCATCGGAAGGCCGGTGGTGTTCTCGCTGGCGGTGGCCGGGGAGGCCGGGG
TGAGCAACGTGCTCAAGATGCTGCGCGACGAGTTCGAGCTGACCATGGCGCTGAGCGGCTGCAACTCGCTGGCCGACATCACCCGCAACCACGTCGTCAC
CGAGGCCGACAAATTCGGCGTCATGCCGTCCCGCTTGTAACTTGGAACCAAATCAAGTCGGTCCACGTCGCCGGCGGCCGTATAGCGATCAAGGCTCACG
TACGTAACGGCATCGATGCGTGATAATGCTACCTAGTGTAATTAATTTTGGACGGGATGTGTGTGTGTGTGTGTTTCCGACTTCCTAAGTGCTGTGATAT
GGCATGGATCGATTAAACATGATAAATGAATTAAATACGTACATTATTCCTCGCAAAAAAAAAA
page-top