Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1430  (registered. 2002)
Contig Information
Length 742 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_34969 [Oryza sativa Indica Group]
Score 124
Evalue 3.62799e-05
Total Hit Count 50
Registered year 2002
Contig Sequence     [ Download ]
>Contig1430
catctccctctgttacaatatatttttctagcaagcctggcaccaatggaaatggtgcaaaccacctccttagcattctctggaatTGTCATCATTCTCC
TTTCCATGGCCATCACCGCTCAAGCTTCCGACACCAAGCCCATGTCATCAGCCATCATGTTGGAAGCATGCAAGAATGTCTCGAGTAACTTCTTCAAGGT
GCGCTTTACATATGACTTTTGTGTATCAACGCTCCAATCAGACAAACGAAGCACCGACGCGAAGGACTACCGCATCCTAGCTCTCGTGGCCGTCGACGCC
ATGAAGCCCCAAGCCACGGCCATGACGGACAAGGTTGAGAACTTGATCCATGGTGCCACCAAGGACAAGCTCGCGATTCGCGCCCTTGGGTTCTACCGAG
TGGACTACGGTGGCATGATGAGCACCCTTGAAATCTGCCAAGATATCATCCAGAGCTTTGAGATTCGCAAAGGCAATGAAGGTCCAACGCCCTTCGACTT
GCCTGATTGCATTGCGAAAACAACCAAAGCCATCAACGATTGCGCTGACAAAACAGAGTTTACGTCGGTTTCAGAagggctaacaaaggaatatgaggag
ttatctatgatggccagcctcagcagttgtttgctacatctctacatcacttcacctcctcctcgtggactaggattagatattcctagtaactagaatt
gtatgatgaggttaaaatttgatgttgttcatatcgtttggg
page-top