Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3849  (registered. 2012)
Contig Information
Length 901 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_OKCS Seed DPA5 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|224579188|gb|ACN58181.1|| putative ethylene responsive element binding protein [Dasypyrum
Score 347
Evalue 1.00E-93
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3849
TTTTTTTTTTAGAGGGGGAAAACGATCGAGTGCACAGATTAAAGCAAACTGGACACAAATCCATGCTGTTCACATTCAGAAATGGTAGCGACGACATAAA
AGTTGACAAAAGTTAAAGACAACGGTTCATCAGACTCATAAATGACAACGGTTCATTGACAGTCAACTAGGGAAAGGGTCGACTACAACTCAAGATGCGG
CTTTTTTGCATCTAAGCTTGCACATAGGCATATACTAACCAAAGGTGACAACAGGGTGCTTCCCAATCTCCCATAGTCTTATTCCCTTTGTCCTGATATA
CAGGGGTTTGAATCCCTCAGAAAATTTCGCCACAGATGGGCATGTCATCGAAGCTCCAAAGGTCCATGTTGCCAACGACATCCTGAGGCACATCAAAATT
CAGAAGGCTATCTATCGGCTCATCCACGCCATCATCAACAAGAAACCTCATCCAAGGCTCAAAATCGACAGCATTGTTCTCCATAACAGGAGGCACCACT
GAGTTGTAGGTGTTGCTCTGGACAAGCGCAGATTCAGCTCCTTCGGCAATCACTGCTGGGTTGTAGGTGTTACTCTGGAGAAGTGCAGACTCTGTTCCTT
CAGCAATGGTGGAAATGGGAGCAATGGATGATATATCTGGAGTCTTGGTGTCATACTCCCAGCCCAAGTCAGAGCAGCCAAAGGAGTTGCTTCCCTGGTC
AGAGTACATATTCATAACAGGAGCTTCAACAGGGGCAGCAGAGTTAATTGCGGGAACATATGGCACGTTGTCAGGCTGAACAAGTGGCTGCTTTGATGCA
AAGTCAGCAGGCGGGTAGACGAAAGCATTTGGGTTGGCAAGGTTGTTGACTGCTGGTATGACGGTAGGTTCCTGTGCTGCGCTTGACTTGGGAACTTTAG
G
page-top