Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3829  (registered. 2012)
Contig Information
Length 1055 bp
Clones alternative view 47 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_r Root 6
Wh_yd Spikelet at late flowering 7
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 5
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115464893|ref|NP_001056046.1|| Os05g0516600 [Oryza sativa (japonica cultivar-group)]
Score 413
Evalue 2.00E-113
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3829
TAAGGAACACCACCTAGAAAATGTATTTCCAGGAGGGGCCATTGTACAAGACCAGATTTAAGCTTCTTTCACACAAAACCATAATGAAGCAACTGTAGTT
TACACTTCACTTATTTCGCCTGACTGTATTCACAAGATATGACGCTATTCATGATAAAACTACACAAACGTCCACAAATTGACAGCTCGGAACAGACGCA
TCAATCATTCCTTGGGCACTTACGAGGTGATTGAAAAAGGTCACAAATGAAATACGGGCCCACAAGTCACCATGGAAATACAGTAATGTCAAAGGAATAG
CTGACAGTTGTGGCCTCAGGTTCTAACAGCATCCTGATGATCCTTGACCCCGGTTGCCACCCACCACGTCCACGGTGTCCGGCATATACAGTTCTTCCTC
TGGCTCGTTCTTCAGAGCGTTCTTTACTATACACTGGAAAGCTTCCTCCACGTTGATTCCATCCTTGGCAGAAGTCTCAAAGTATGGGATGTTCCCTTTA
GAGGCACACCATGCCTTCGCCTTTTTCTCAGAAACCACGCGACTATTCCCGCCATCTACATCAACTTTGTTACCCAGCAGAACAAAAGGGAAGTTATCAG
GATCTGATGGGCTAGCCTGAATTAGAAACTCTTCACGCCAGTTGTTCAGATTATCAAATGATTTCATTGAGTTAACATCGTAAACTAGAACACAACAATC
TGCACCGCGGTAGAATGCAACACCAAGACTTTGAAACCTCTCCTGACCGGCAGTATCCCATATTTGTAGGGTGAAGAGCCTGTCCTCGAACTGCACCTCC
TTGGTGAGGAAATCGGCGCCAATCGTAGCCTTGTACTGGTTGCTGAACTTCTTGTTCACATATTGGTTCATCAAGGAAGTCTTCCCAACCCCGCTGTCGC
CGAGGATGATGACCTTGAGGAGGGTGCGGCGGCGAGAGGCCATCGGGATCTAGGGTCCGGCGCGATCGATCTCGCTCGCGCGCCGGAGGGGACTGGAAGG
GGGCGGGGGAGGCGAGGCGAGACGAGACGAAAGAGCTGAGCTGTCGCGGCGCGTC
page-top