Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig980  (registered. 2002)
Contig Information
Length 446 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_17137 [Oryza sativa Indica Group]
Score 325
Evalue 6.23824e-29
Total Hit Count 37
Registered year 2002
Contig Sequence     [ Download ]
>Contig980
ggttcatgtctgcgcaggcaaaccagggaCCGAGCTCTCGGGTAACCCGGCCCGACCTTCTGTACACCGGTCAGTCTATATTCTTTGGTGGACCTCTGAT
GACAGATTCTGCGACGAGAAGTTTCAGAGACCCTGGCGGCTCGAGCCAGCGCTCCGGTGTGTCTCGGCCTCACCAGCTCCCCGTGTTCATTCCCGCTGAT
CCCCAGAAAGATCACCTCCCCAAGTTGCCATGAAATGAACTGTTTTCGGAGTATCCGCGCGAAGCACCTGTTTCTCTGCTTCATGGTGGCATGATGCAAT
GTATAGTTCTCAGTTCTTGCATCAGACCTTTTAGGTTATGATTTTGTGTCAGCTaggtggaAATTGAAATTAATTTAGTAACGATTGTAATACAGAATca
tgaagtctcttttgtttatcaaggaaaaggatgtctaaaaaaaaaa
page-top