Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig977  (registered. 2002)
Contig Information
Length 728 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 714
Evalue 1.33697e-73
Total Hit Count 243
Registered year 2002
Contig Sequence     [ Download ]
>Contig977
cgagcggtccctccgtctccaccacaccacgccacggccgaccaaggcgaggagagaccaaccaaaccaaagagagcactacaaaaggaggagggagaga
gccagaagctctaccacgttcgaccacgcacgcacgcacgcacgcctgaagaatcaatctcgCAGCTCCAGCAGCGGCGGCGCCTCTCCGGCGGCATGGC
CAaggtaagGAGCAGGAGGAGGGCCCAACTGGAACGGCCTGCTCAAGTGGAGCCTCGCCCACGGCAGCGACGGCACCAACCCGCCCCGCGCGCTCAGCGA
GGAGGACAGGAAATGGTTTATGGAGGCGATGCAGGCAAATACAGTCGATGTTGTTGGCAGGATGAAGGAGATTGCCCAGGTGATGAAAACCCCTGATGAT
GTGTTGCAGTCTCATGGCGTCACTCCAGAGAACATTGAAGATATGCTTGATGAGTTACAAGAGCATGTGGAATCCATTGATATGGCAAATGATCTTCATT
CTATCGGTGGACTAGATCCTCTACTTGGTTACTTAAAAAATTCACATGCTGGCATCCGAGCAAAGGCAGCAGAAGTTGTGAGTAcggttgttcagaataa
cccgaaaagccagcaacttgtcatggaatctaatggactggagccactattgacaaacttcangtctgatcctancacgactgcncgcacaaaaagctct
tggagctatctnttctntgattcnnaat
page-top