Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3784  (registered. 2012)
Contig Information
Length 857 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_OKCS Seed DPA5 2
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig3784
TTTTTTTTTTGAATGAGAAAACACTACCCAAGATACATATCATTTAAAATCCATTAATAACACATCCAAACATAAAGGAGGGTCCAAGAAATACATCGCA
ACATTTGATTCTAAACTGTTTGCCACGCCCCTAAGAAATGCTCATCACAACAGCCTCTAGCTGGCTGATAAGTCTACTCATCAGAATACTCATCAGGATC
ACAGAAACGAACCGGGGTCTCCAACACATCGGTGACCAGCTTGACCAGCGATTGGGCACGCTCCTGAAGACAGACAATGTCGCAATTACCTTTGAGTACA
TCATCAGCAGTATCCTTTAGCATTATGCTCAGCTCTTTGACTCGGGCTAAGACCAGATCCTCCTCGGCAAGCAATACGCCCAAGGATAACTGAAAGCACT
TCCTCAGATCTAAGAGCGTAATTGCTGAGTTCTTCATGAGTAGGAGGGCTTCCAGGGCGCCCTCTTCCAGCTTGGCCTCCTGAACCATGAGCTGGGGTAA
CACATCATGCTCAAGCTTTTGGATTTCCAGCGACAAGCCTGCCACAACCAAGAGGATTTTCAGCTCCGAGCATGCCCAGATCCACGACTCGTTGATCAGC
TGGCGGAGGAGTGCATACGACTCGCACGCTATGCGCACCGACTCCAGAGAGACAAGATTCACAAGCATGGACTTATTGGAGTGGCCCAGCTGATCGGCGC
TGGCCTGCAGGTCTAGGATGTGGGCATGGGAGTGGATTTTGTAGACCATCATTTCCTTTTGGCGGACTGCAGCAGAAGAGTTGCTGCTACCAGCTCGGGC
GGGCGGGCGGGCGTAAGATCCCGATCTGGAGAGGACGAGGCGCCGTCGGGTGATTGA
page-top