Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3783  (registered. 2012)
Contig Information
Length 940 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 1
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 1
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 1
Wh_SHC Shoot grown with cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 1
WH_XA Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|146760217|emb|CAM58984.1|| beta tubulin 6 [Hordeum vulgare subsp. vulgare]
Score 600
Evalue 7.00E-170
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3783
CCAATCTCTCCTCGCCGCCACACTCCCCACTCCCACTGCTTCGTCGAGCCAGCTCGCCAACCAGAGAAGATGAGGGAGATCCTGCACATCCAGGGTGGAC
AGTGTGGAAACCAGATTGGTTCCAAGTTCTGGGAGGTGGTGTGTGATGAGCATGGCATCGACCCCACCGGGCGGTATGTCGGCACCTCTGACCTGCAGCT
GGAGCGCGTCAACGTCTACTACAATGAGGCCTCCTGTGGTCGCTTTGTGCCCCGAGCTGTCCTTATGGATCTTGAGCCTGGTACTATGGACAGTGTCCGT
ACTGGACCGTACGGGCAGATCTTCCGCCCTGACAACTTTGTGTTTGGGCAGTCTGGTGCTGGTAACAACTGGGCCAAGGGTCACTACACCGAGGGTGCAG
AGCTTATTGATTCTGTTCTTGATGTTGTCAGGAAGGAGGCTGAGAACTGTGACTGCCTTCAAGGTTTCCAAGTATGCCACTCTCTTGGTGGTGGTACTGG
ATCAGGCATGGGGACCCTTTTGATATCAAAGATCAGGGAGGAATACCCTGACCGCATGATGCTTACGTTCTCTGTTTTCCCCTCACCGAAAGTATCTGAT
ACTGTTGTTGAGCCTTACAATGCCACTCTTTCCGTCCATCAGTTGGTTGAGAATGCAGATGAGTGCATGGTTCTTGACAACGAGGCTCTTTATGACATCT
GTTTCAGGACTCTCAAGCTGACCACTCCCAGCTTTGGAGATTTGAACCATCTGATCTCTGCCACCATGAGCGGAGTGACCTGCTGCCTGAGGTTCCCCGG
CCAGCTGAACTCCGACCTCCGGAAGCTGGCAGTGAACCTGATCCCCTTCCCACGTCTCCACTTCTTCATGGTCGGGTTCGCGCCGCTGACCTCCCGCGGC
TCCCAGATGTACCGCTCCCTCACGGTCCCGGAGCTGACCC
page-top