Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3781  (registered. 2012)
Contig Information
Length 1491 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_CA 1
WH_SP 1
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195638270|gb|ACG38603.1|| ankyrin repeat domain-containing protein 2 [Zea mays]
Score 561
Evalue 6.00E-158
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3781
CTCACAAAGATTTTCTGAAGATGAAGAGAACGGAAGCAGAAAGCCTAATTTTTTTTTTAAACAAAATTTGCACCTCACGTATCATTTTCAACACCAAGAA
ATATTCACGAAAGGGGTATATACGCAATCATCATCACCCCTGACATCTCCCACAGCGAACCCATATCCCCCGTGCATGGAGATGGACCAAGAACAGGGTT
GCACAGCAGGATCAAACCAACGGAGAAGATGGACTCTTGTTAAGTAGCACCGCAAGGCCACACAGGTTACATGCGAGAGCTACCAACTAAGTAAACCGAG
GGAAAGCAACCAACACCATGCCAGGATATGACACCGCCGAGAGTCCCGAACCAAAGGGAGAGTTTTAGGATCGATGGGCGGCGGGTCTGAGGGTTTTGCT
TCATAGGAACACGTCCTGCTCAAGCAGCTTCACCACCTCGCCCTGGCTGTTGAGCTTGGCCACCTCGATGGGGGTCTTCCCATCCAGATTTTGGAGCGTG
ACAGCAGCGCCGTGCTTCAAGAGAAGATCCACGCATTCCTTCCGACCGTATCCAGCGGCATAGTGCAGCGGGGTGTTCTTGTTCTTATCCAGTGCGTCAA
CTGCAGCGCCTGCCTCCAGAAGGATTTCTGCACACTTCAACTCGCCGTATCCACATGCAAAATGCAAGGCCCTTCTTCCCTCCAAATCTTCTTCATCCTT
GTTTGCTCCACCATCTAATGCTTTCTTCAGACCCTCTGCATCACCGACACTGGCGGTGTTATGGACAATGGACTCATCATCATCCTCGCCTTCTTCATCA
GTTTCTTGAGGTCCAGATAGTACAGTGGAAGTAGCAGCATCTACTGGGAAGTTCAATGACATAGCCTGGCCAATCTTTTGAAGAATCTCAGGGTCATTCC
AGTACTTCACCATTGCAGATGGACCACCACGCTCTATCTCATCAAGAATTGGCTTCAAAGACGGATCATCCTTGATACGGGCCATTCGCTCTTCAAGCTG
CTCTTTGTGAGCTGGACTAGTCAAGTTCTCAAGCATACTGGACATTGCAGGATCCTGCATAAGAGTATTCCCAAGACGCTCCGCCATTGACATAAACTGA
GGATTCTGCATAACTTGTGTCATGGTTTCCATGTATGCTTGAGGATCCAAATTTGGAACACCCTGTTCCCCTGCACCCTGCGCACTTTTCTGAAGCTGCT
CAGCCATCTGGTTGAATACAGGGTCGCTGGCGATTTGCTCAGCCATCTCCCTTATAGATGGATCATTAAGCAAGCTGCTCATGTTGGAAAAATCAAAAGG
ACTGGGAAGGCCTGCACCAGCTGTCGGGGAAGCCCCCTTTTTTGCCTCAGACAGCCCCTCCGATTTGGAATCTTTGTTCGGGTCGGAAGCCATGGCGGAT
CGGGCGGGCGGGCGGCGGCGACGCGGAGGAGGCTTGCGAGGGAGGGAAGGCAGCAGCGGTGAAGCGGCGAAGGCTATGAGAGGAGAGGAGA
page-top