Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3780  (registered. 2012)
Contig Information
Length 1507 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_SHDr Shoot grown with dessication 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 1
WH_XC Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242069153|ref|XP_002449853.1|| hypothetical protein SORBIDRAFT_05g024430 [Sorghum bicolor]
Score 664
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3780
ATAATAATTACCCACCCACATTACATTATATTACAACTCTCGACCTAGCTATAGCATAGCTAGGGATGCAAATGGACAGCGTCGACGTTTGTCCATGAAA
GCATAATTAAAACATGCACGGTTATTAAAATAACAAAGATTATCGGCCGTTTGCATCCTTAAGCATAGCAGCTAGCTAGTGCTTCTTCGTCTCTCTTCTC
TTTCGCTCAAATCGTCCTCTTCTCTATTTGGAGTTGAGGTTGGTTTGGCGCAGCTTGCGCTCCTCAGAGAGCTTCCTGGCGAAGCGCGTGAGGGCCTCTT
CGTTGGTGCCCTCACCTTCGACGGATTCATACATCCCTGTGTCAATGTTCACCCGGGACACATTCTTCTTGAGCAGATTCTTACCGATCCCGATAAGCGC
CTCCATGTTCTCTTTGGTGGCGATATCGACCGAGGATGTGTGCCCCGTGAGCGAGTCGTCCTGGATGCGTAGGTAGTTCTTCTCAATGCGGAGGGCCTGA
AACAGCACGGCAGCGTGGATGTCGACCATGTCGGCGCTCGCATGGGAGAAGATGTCGATGAGCGGGGTGAAGCCGCCGTCATAGAGCCATCGAAGGACGC
CCCACTTGGCGCAGTCGGGCGCGGTGTACTTCTCCGCCATCTTGGCGGACCCCGTGCCGATGGAGATGATGAGGTAGTTGCCGTACTCGGCGGGCTTGCC
GTGCGTGAAGTCGGGGTTGCGGCGCAACACCTCCTTGGTGATCATGGACATGGCGGCCATGGTGGGGTTGTTGGCGGCCACGCCGCCGTCGATGAGGTGG
TACTCGCGGTCCGGCAGCTTGCCCGCGGGGTCGCGGGTGGTGAAGTAGTGCGCGGGGAAGTAGGTGGGCGCGGCCGATGTGCTGATGCAGATGTCGGAGA
GGTGCGCGTTCTTGAGCGGGTCCACCTTGGCCTCGTACGTGTTGAAGATGATCGGCTGCAGGTACTTGACGTCGAACGTCGGGACGATGATGTTGGTGAC
GGTGTCGGCGACGGTGACGTCGTTGGTGAGGTTCTTGATCTTGTCGTGCAGGAACTTACCGTCGTACTTGGGACCCATCACCGCGCCAAACATATTCGCC
ATCGGGGTCAGAAATCCCCAGCTCTTCTGCGGGAAGATCTTGGGCCCGTTCTCAAGGTAGAAGTTGTTGATTTCCTTGGCCTCGAAGAGCGGCCGCTTGT
TCTCTCCGGGCGCCGCCAGCATCGAGGTAACCAGCGCGCCTGTGCTCGTCCCGGCGATCACGTCGAAGTAGTCCGCGACGCGCGCGTCCGGCCCGTCCAG
CTCCTGGAGCTTGGACTCGAGGCAGGCGAGGATGGTGGAGGGGATAAGACCGCGGATGCCGCCGCCGTCGATGCTCAGCACCGTGATGAGCCGCCCCTGC
GACGGCGGCGGGCACGTCACGCACGCCATCGCCGGCTCCGCGTGGCCATGGCTGCACATCTTTAGCTGCTTCTTGGCACAGCGCTCTATTGAGCTTTAGC
TAGTGCT
page-top