Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3779  (registered. 2012)
Contig Information
Length 688 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 2
Wh_OKCS Seed DPA5 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|32812836|emb|CAD98749.1|| ADP-glucose pyrophosphorylase large subunit [Triticum aestivum]
Score 343
Evalue 1.00E-92
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3779
CGTCTCTCCTCTCCTCTCTCTGCCCTCACCACCACCACATCGACTAGCGGGGCCACCCCCGGCCTCTGCCTCCCTGCATTTGATTCATCCGTCGCTTGCC
CGGTCGCCCGTCGATCCGTTAACCCGCCGTCCGTCCGCCCGTCCCCGGCAGCCGCGCCGCAGTTGCAGGTGGACTGCGAATGTCATCGATGCAGTTCAGC
AGCGTGCTGCCCCTGGAGGGCAAGGCGTGCGTCTCCCCCGTCAGGAGAGAGGGCTCCGCCTGCGAGCGCCTCAAGGTCGGCGACAGCAGCAGCATCAGGC
ACGACAGGGCCTCCAGGAGGATGTGCAATGGCGGCAGGGGCCCCGCCGCCACCGGCGCGCAGTGCGTGCTCACCTCCGACGCCAGCCCGGCAGACACCCT
TGTTCTCCGGACGTCCTTCCGGAGGAATTACGCCGATCCGAACGAGGTGGCGGCCGTCATACTCGGCGGTGGCACCGGGACTCAGCTCTTCCCACTCACA
AGCACAAGGGCCACACCTGCTGTTCCTATTGGAGGATGTTACAGGCTCATCGACATTCCCATGAGCAACTGCTTCAACAGTGGCATCAACAAGATATTCG
TCATGACCCAGTTCAACTCGGCCTCGCTTAATCGCCACATTCACCGCACCTACCTCGGCGGGGGAATCAATTTCACTGATGGATCCGT
page-top