Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3769  (registered. 2012)
Contig Information
Length 841 bp
Clones alternative view 30 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 6
Wh_r Root 1
Wh_yd Spikelet at late flowering 2
Wh_SH - 2
Wh_VSCB Liquid cultured tissue 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XV Leaves, plant was grown at constant 23℃ 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242074068|ref|XP_002446970.1|| hypothetical protein SORBIDRAFT_06g026070 [Sorghum bicolor]
Score 271
Evalue 9.00E-71
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3769
TTTTTTTTTTATGGTGAAGAAAACTGCAGATTCATTTCAGAGTTAAGAGCTGAAAACATCTCTAAAACAACCATTTCATTACACTAAACACCACCCACGA
TACATAAACTTGCCTAGCAGAACCGAAACCTAAACAAGGGAGGATGAGGCATCCTTTTGTACAGACCCTTGGAACACCAAGCACTCCTAAGACCAGCTAT
CGCATCAAGATCAAGCGGCGGCGACCTTGCGGGCCTTCTTGGCGGCCGGGGAGCGGACGGTCTTCGGCTTCGCCTTGGCCTTGGCAGCCGGCGACTTCTT
GGCCTTGGTGACCAGCTTCTTCTTCTCCGGCGCCTTGCGCTTGGTGCCAACGGCGGCCGTCTTCTTGGGCTTCTCGGCCGCCTTCTTTTTGGGCTTGGCG
GCGTCCTTGGCGGGCTTCGCCGCGGGCTTGGCCTTGGGGGAGTCCTTCTTGGCGGCGTCGGAGAGCTTGTAGGAGGCCTTGACCTTGACGAGCTTGCCCT
TGGCGGCGGAAGCGCGGAGCTGGACGGAGAGCATCTTCTTGAAGTTGGGCGGGAGAGCCTTGCCGTGCTTCTCCTCGATGTACTTGGCGATGGCGACCGA
GCTCGACCCGGTCCTGTCCTTGAGCGCCGCGATCGCCTCCTTGATCATCTCAAAGTAGGTCGGGTGGGCGGCTCCAGCGGCGGCCGCCTTGGGCTTGGCG
GCGGCGGGCTTCGGCTTCGGCGCCGCGGCGGCGGGCTTGGCGGGGCGGGCAGCGGGCTTGGCGAGGGCAGGCATGTCAGCTGACTGAAGCGGAGCTCTGA
AACCGAAACTGAAGCGGTGCTACTTGCGCGGTGTGCTCGCT
page-top