Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3762  (registered. 2012)
Contig Information
Length 581 bp
Clones alternative view 27 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Wh_oh Pistil at heading date 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XA Root 2
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|32400865|gb|AAP80664.1|AF479045_1|AF479045_1 S28 ribosomal protein [Triticum aestivum]
Score 138
Evalue 4.00E-32
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3762
TTTTTTTTTTTGGATTCAATATAGTCGATTCTCATTACCGAGAGGTGTGCAACAATAACATCAAGTGCATTTTAATTTCAGCAACAGAAGGAAACTCATT
ACATCTCCATAGCCAAGGCAAAAGACGGAAGCAGTAGAGTAAGAAGGCAACAGCACACAATTTCAGGAGTACTTCCGAAGACAGACAGGTGAAGAAAGAA
AGTGCTTAGCGCAGCCTCCTGGCCTCCCGCTCAGACTCGAGCAGGGTGAGGATGTCGCCCTCCCGGACAGGCCCCTTGACGTTCCTCATGATGAGACGGT
TCTGGTCGTCCAGGAACTTGACTCTCACCTGGGTCACCTGACCCCTGGACCCGGTGCGGCCCATCACCTTGACCACCACTGCGAGCTTCACCTGCGTATC
CATGCTTTCTTTGGTTGTTGGCGATGGGGATCGCTGCTTCTGCTGAGACGACGGAGGCGGCGGCGCAAGGTGCTTCTGCTTGTGCTACAACGGACGGAGG
CGGCGGCGCAAGGTGCTTCTGCTTGTGCTACAACGGACGGAGGCGGCGGCGCAAGGTGCTTCTGCTTGTGCTACAACGGAC
page-top