Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig282  (registered. 2002)
Contig Information
Length 604 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gamma-gliadin [Aegilops searsii]
Score 168
Evalue 1.83024e-10
Total Hit Count 240
Registered year 2002
Contig Sequence     [ Download ]
>Contig282
gctagagcacaagcatcaaatccaagtaggtagtagttaacgcaaatccaccatgaagaccttactcatcctgacaatccttgcgatggcaataaccatc
gccaccgccaatatgcaggccgaccctagcggccaagtacaatggccgcaacaacaaccattcctgcagcctcaccaaccattctcccagcaaccacaac
aaatatttccccaaccccaacaaacattcccccatcaaccacaacaaccttttccccagccccaacaaccgcaacaatcattcccccaacaacaaccatc
gttgattcaacaatctctacaacaacagttgaacccatgcaagaatttcctcttgcagcaatgcaaacctgtgtccttggtgtcatccctctgttcaatc
atcttgccaccaagcgattgccaggtgatgcggcaacaatgttgtcaacaactagcacaaattcctcagcaactccagtgtgcagccatccatagcgtcg
tgcattccatcatcatgcagcaagaacaacaagaacaactacagggtgtgcaaatcctggtgccactgtctcaacagcaacaggtgggtcaaggtattct
cgtc
page-top