Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig373  (registered. 2012)
Contig Information
Length 975 bp
Clones alternative view 48 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 6
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 5
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 15
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_CA 1
WH_SP 2
WH_XA Root 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|399414|sp|Q03033.1|EF1A_WHEAT|EF1A_WHEAT RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha
Score 242
Evalue 5.00E-62
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig373
GAGGATAAAAATGAGTAGTCTCAGAAGCTTNNATGTTTTGTCAAAAGCCGAAATTAACGACAGTACTCAAATGACACATCAACAGGGCGCATATCACACG
GCGCTAACAGTAGCAAAACTTAATAGGCACTAAACTACTAGAGATCTCAAAAAGCAGACATAGACGGATTCAGGTAAACGCCTCATTTCTTCTTGATGGC
AGCCTTGGTCACCTTGGCGCCAGTTGGGTCCTTCTTCTCCACACCCTTGATGACACCAACAGCCACAGTTTGCCTCATGTCACGGACAGCAAAACGACCA
AGAGGAGGGTAAGTGGCAAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACTATGCCAGCATCGCCGTTCTTGAGGAACTTGGGCGCGGCCT
CTATCTCCTTACCAGATCGCCTGTCAATCTTGGTCACCAGCTCAGCAAACTTGACAGCAATGTGTGAGGTGTGGCAGTCCAGCACTGGGGCGTAGCCGTT
GCCAATCTGACCAGGGTGGTTCATGATAATGACCTGGGAGGTGAAGTTGGCCCGCTAGGGTGTTCGTCCACACACTCCCGCCGCCGCCATCCCCGCGAAC
CGGAGAGCGAGGCCGACACCGCCGCCGCGATGAGGGCCAAGTGGAAGAAGAAGAGGATGAGGAGGCTCAAGAGGAAGCGCCGAAAGATGAGGCAGCGATC
CAAGTAGGTGCCTTGGAGGGAGGGGAAGCATCATCTTACATCCAGGCAGCGGAACTCTGAGGGATGATGGCATTGTCCGAGTGATTCCTGATTTGTTTTG
CGGTTGTGGCTGTGGAAGTTGCTTTACCTGTGTTTAGCTGTTTAATACTAGTCTGGCTATGTTCCAGGACTGAGTTTTATGTAATGTGAGGATTATATGT
GTTTGTGACTGAATTTTATGCACCTATTATCTTTGAGGTACTCTGAAAAGTGCCTTTTGGCCCTGCAAAAAAAAA
page-top