Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig151  (registered. 2002)
Contig Information
Length 713 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0477500 [Oryza sativa (japonica cultivar-group)] >gi|42407856|dbj|BAD08998.1| putative patatin [Oryza sativa Japonica Group] >gi|113624013|dbj|BAF23958.1| Os08g0477500 [Oryza sativa (japonica cultivar-group)] >gi|125561904|gb|EAZ07352.1| hypothetical protein OsI_29602 [Oryza sativa Indica Group] >gi|125603756|gb|EAZ43081.1| hypothetical protein OsJ_026564 [Oryza sativa (japonica cultivar-group)]
Score 160
Evalue 2.21858e-09
Total Hit Count 78
Registered year 2002
Contig Sequence     [ Download ]
>Contig151
cacaaataatggcactgcgaataaatttagcgtgctaatcatggtttaacagaggaaatgctaactaaggtagaaatccagcaagaataatcatttagtt
ccattatcaacatgtatctgtgtaaatcatccatgccaaaatgtgttgctgctgggatagtcactactgaaactttcaagatcaacttctttgaacattt
tcattggctagctttaggaaacggcaagttcatggccgtctccatcggctgcgggctgaacccgaaagagagctacagcgccaaggacgccgccaagtgg
gggatcctgaactgaatcgtcaaggatggcactgcccccatcgtcgacatgttcaatgtcgccagcgccgacatgatggacataagcagctaaagctgta
gagatgcattaacacaaaaacacaagataattcccaacgaaaaactgacaagagcatgaactcatttgtatacaccctctgttttctccacaagatattc
ctctgcttatgagttaacatgtgcaaattcatgaacaaattgaaaaatgcccaatggaagaaaacacaaaactgcacctctaaattggtactccctccgt
tccaaattacttgtcataaaaatggatgtatctagaactaaaatacatctagatacatccatatctgcgagaagtaattcggaacgaaagggagtacttc
aaaattacatacc
page-top