Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig134  (registered. 2002)
Contig Information
Length 636 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_01481 [Oryza sativa Indica Group]
Score 745
Evalue 2.5352e-77
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig134
cctcgtacaccgccgccgccgccatggnaccccaaactcctctctatgcaggaggaaccatccaaccagagaaagaaggataaaaagagcaagaaggaga
agaagccgaagccagcggccgaggccgaggccgaggaggcagcggcggaacaggaggaaccatccaacccaggtgctcgactgctgcaaggggttcgacc
ggccgtcgcccatccaggcgctagcctggccctatctcctcgatggccgcgatttcattggcatcgctgccaccggatctgggaagactattgcgtttgg
tgtgccggcgctgatgcacgtcaggaagaagctgagtgaaaaaggcgccaagaaggggttgccgcgatgcctcatgctggctccaacaagggagcttgct
caacagatcgcagatgtacttactgaagctggtgcgccatgcgggataaattcagtgtgcctctatggtggaacatcaaaaggaccccaaatatcttccc
ttaaatctggagttgaaatagtcataggaactcctggtcgtatgaaagacctcattgaaatgggtgtttgtcgtcttaacgaggtttcttttgtggttct
tgatgaagcagatcggatgctggatatgggttttga
page-top