Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig37051  (registered. 2012)
Contig Information
Length 1294 bp
Clones alternative view 28 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 3
Wh_CSEC Callus 6
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_VSCB Liquid cultured tissue 2
WH_SP 2
WH_XB Root 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115481496|ref|NP_001064341.1|| Os10g0321700 [Oryza sativa (japonica cultivar-group)]
Score 366
Evalue 4.00E-99
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig37051
GAGGCTGAAGCCCTACAGGCTCCCGCCGCCCCCCTCCCCCTCCCGCTCCCAAACCCTAACCCCTCCGCCTCTCATCGCCGCCACCGCGGCTCTCCCCTTC
CTCGTCGCGACATCCCGTCCCCGCCCTCTCCACCGCGTCCACAATCTTCCTCCATTAGATTTCGAGGGGTCTCGGAAGGATGGCGTTCCTGCAGAAGGTC
GGGAATGCCCTCAAGCGGTCCGCGGGCTCCGGCTCGGCGATGCTCCAGGCGGTCCGGTCCATGTCCTCCTCCAAGGTCTTCGTCGGAGGCATCTCGTACG
GCACCGATGACCAGAGCCTCGCGGATGCGTTTTCCAACTACGGCCAAGTCGTGGAATCCAAGGTGATCATGGACCGTGAATCTGGAAGGTCAAGGGGGTT
TGGTTTTGTGACCTACACTTCGGCGGAGGAGGCTGGAGCTGCCATCACCGGAATGGATGGGAAGGATTTGCAGGGTCGGATAGTGAGGGTGAGCTATGCT
CATGACCGTGGTAGTCGTCCAAGTTTTGGTGGTGGGGGTGGCTATGGCGGCGGCGGCGGTGGCGGCTATGGCGGCGGTGACGGTGGTTACGGTGGAGGTT
CCTGTGGTGGTGGTGGAGGCTACAGCGGAGGTGGTGGATATGGAGGTGGAGGCAGAGGTGGTGGATACAACAGTGGTGGCAGTTATAATTCAGGGTACAA
CAGTGGGGGGAACTATGGTGCCCCTCAAGGCGGGCAAGGTGGCTATGGGGGTGATGCTGGTTTCACAGGGGTTGGTGGTGGTGGATACAATGCTGCTCCT
GCCAACAACTATGGCGGCAATAGCCTGAATCAAGGGGGTGGAGCACCTCCTGCATTTGGAGGTGGAAACTATGGCGCAGGCAACGACAGCTACGCAAACG
ATACCCCTGTCGATCTGCCCCCTGGTAAGCTCGATGACCTGCTGAAGGATCTCAAATTCGATGTTGGTGGTAAGGAGGATGGTGCTGGGGAGGACGCTGG
CTTGGTTGACGCAGACACCAAGAGAAGCGAGGGACAGGACGACTTGCTTGACGACGACTTCAGCAAGGATGAAGATGACTACGCCAACAAGAGAAGCTGA
ATGTCGGTCCAGCAAGAAGCACTAGCCGAATAATTTTCCATGGATGTGTTCTCCATGACCGCCTTGTTTTTGGTATGTCCTGTGATGAAGATAATAATGT
AGTGCTTGCAAACAAGTTATGTTCGGTCTCTTAGCTACGTTCTGTACGTCTGTTTTGTGTACTGTGTGCTGGATTCATGCGAACTTGAACCTGA
page-top