Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig37017  (registered. 2012)
Contig Information
Length 886 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 2
Wh_yd Spikelet at late flowering 1
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242056867|ref|XP_002457579.1|| hypothetical protein SORBIDRAFT_03g009760 [Sorghum bicolor]
Score 375
Evalue 4.00E-102
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig37017
AGACACTTCCCATAGTCTACAAATGATCCCAGCAACCACATTGTAACTAATAAAATCACCTTACACACCAACAGTCAAACAAATTTACGCAACCATATAT
CTAGGATTATCGTCAACTTACAGGCTTTCCCTATCACTAAGATAAACCTTTTCTTACAGCAGCAGTTTTCCCCAGAGCATCAAGGGTGAGGAGAGGGACA
AAGAACCAGGACCTGAGTACTGCCACGCTGGACAGCAGGAAGGCCCCTCACTTGATGTACTGGGACATCCATTTGAAACCTTCGCCATAGCCCATCTTGC
GGACAATGCTGCACATGAACACCTCCAGGGGCCGCACATTTGAATCCGACAAGTTCACGTTGCCCTTCCCAGTGGTGAAGTTGCTCAGCCCAAGGTAGTA
GCGCAGCTCCTCCTCGGATGCTGCGATAGGTATGTCAATCTTGTTACCCAGTACGAGGAAAGGCACATTCGCTAGGGAGTCATCTGAAAGAAGGCCGTCC
AGCTCCTTCTTCGACTCTGCAAACCGTTCCTTGTCAGCAGCGTCCACCAAGTAAACAACCGCATCCACCTTGGCGTAGTAGTCCTTCCAGACTCGGCGGG
CGATCTGGTGGCCACCGAGATCGAAGGTCTTGAACTTGATCTGGCCGATGCTCAGCTCCTCCGACGTCGGGTACTGCGTCGGCTGGTGCTGCACCAGCCG
CTCGTCCTTGAGCATGTGGAGGAGGGTGGTCTTGCCGGCGTTGTCCAGGCCGAGGAAGAGGATCTTGGCCTCCTTCTGCCACAGCCCCAGCGACGCCAGC
ACCCCGTAGAACCAATCCACCAGNAACATCTCTTCTCGTCCGCCTCCTCTTCTCCGGCGATCTCTTCCTCTTCCTCCTCACACCGA
page-top