Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig37016  (registered. 2012)
Contig Information
Length 448 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|291410763|ref|XP_002721657.1|| PREDICTED: histone cluster 1, H2ag-like [Oryctolagus cuniculus]"
Score 207
Evalue 3.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig37016
GACAGCAGCGAGATGCGGCCGTTCCATTACAACAAAGANNNNGAACACGGACGACCGATGGCTAGCTAGTGAATCTGGCGGCGGGAGGTGGGTTCTGCTG
GACCGGCGCGGCCTAGCCGCCGAATCCGTAGAGGGTGCGTCCCTGGCGCTTGAGGGCGTAGACGACGTCCATGGCGGTGACGGTCTTGCGGCGGGCGTGC
TCCGTGTAGGTGACGGCGTCGCGGATGACGTTCTCCAGGAAGATCTTGAGCACGCCCCGGGTCTCCTCGTAGATGAGCCCCGAGATGCGCTTCACGCCGC
CCCTGCGGGCAAGACGGCGGATGGCCGGCTTGGTGATGCCCTGGATGTTGTCGCGGAGCACCTTCCGGTGACGCTTGGCGCCGCCCTTGCCCAGCCCCTT
CCCTCCCTTGCCGCGGCCCGACATCCTCTCTCTCCGGCGAGCTTGGCT
page-top