Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig37015  (registered. 2012)
Contig Information
Length 639 bp
Clones alternative view 40 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Wh_r Root 3
Wh_yd Spikelet at late flowering 8
Wh_CSEC Callus 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 4
Wh_VSCB Liquid cultured tissue 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 4
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|75102839|sp|Q43215.3|H2B4_WHEAT|H2B4_WHEAT RecName: Full=Histone H2B.4; AltName: Full=H2B153
Score 251
Evalue 3.00E-65
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig37015
TTTTTTTTTTGTTAAGAACTGAAATAAGCACTGTTACTATTTCTCCGGATCATGAAATGTGATCCCACACAACCAGCACAAGTTACAACACGACAGAGCA
CGAGCAGCTAACTACTACAGAGCAACAACATCGATCGATGGATACATCAAAGAAGACACGTGGACGGCGGAATCAGGCGGAGGTGAACTTGGTGACGGCC
TTGGTGCCCTCGGAGACGGCGTGCTTGGCGAGCTCGCCGGGGAGGACGAGGCGGACGGAGGTCTGGATCTCCCGGGACGTGATGGTGGGCTTCTTGTTGT
AGCGCGCCAGCTTGGCGGACTCGCCGGCCAGCTTCTCGAAGATGTCGTTGATGAAGGAGTTCATGATGGACATGGCCTTGGAGGAGATGCCGATGTCCGG
GTGCACCTGCTTCAGCACCTTGAAGATGTAGATCTTGTAGGTCTCCACGCTCTTCTTGGCCTTCTTCTTGCCCTTCTTGTCCCCGCCCTCCTTGGACGCC
GGCACCTTCTTCTCCGCCTTGGGCTTCTTGCCCGCCGGGGTCTTCTCCACCGGCTTCTTCTCGGCTGCCTTCGGGGCCATGGATGCGGATGCGGACGCTT
CGGCGGGGAGAGGTGCTGTGGTGTGTGTGTGGGGGGGGG
page-top