Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36943  (registered. 2012)
Contig Information
Length 434 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig36943
TTTTTTTTTTGTCCGTTTAACATGTATAAGATTGATAACTCTGTTNNNAGTTCTTACAACATCAGCTCAAACTAGGTACTTTTAAGAAGACAAACTATGA
CGACATCAAACAGATTTAGCTGCAACTGTATTAATGTATGACAGTGTTCAGGCCATCCCACCACTGCTCGCTGTCCTGATTATCTGAAACAGAGATGATC
CGATGACCACAAAGATGAAGAATCCAAGCACTATAGGTCCAACAGGATAGTCATTCCCCTTCTTCACAGTGGTTTCAGGCACCGAACCCCTCTTGGTGAT
GTTCTTCTGGAACTTCGATGTCTTCCTGTCAGCAAGGCGCCTGGAAGTAGTCATCTTGGCTTCGGGCGGTGTCCGGTGAGCTCGACGGCGAGGAATGGGA
GCTGGTGCAGCCGGGGCATAGTTTGGCCTCGTGC
page-top