Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36896  (registered. 2012)
Contig Information
Length 974 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 5
Wh_EM Dormant seed with water absorption 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|212723804|ref|NP_001132839.1|| hypothetical protein LOC100194331 [Zea mays]
Score 411
Evalue 5.00E-113
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36896
GTTGCAACGGAATGACCTGAAAAACAATACTCCACCATGCCGATTGCCTCAAAGACCATACAACAATATGAAGGAAGGTCTCACCCTCATCTAGACAAAC
TTCCCGGTTCAGCAACAAACTTCAACTTCTCTAGGTAACATTCATAATAATAATACTTGCTACTACTGCTACTAATAATTCCCGGTCGCTGGAAATGCCA
CATCACAAAAGCTCAGCAAAAAGAATGCATCATGGCGCCTCAGCTAGAGCAGCACCCACCCTTCTTCACCGCCGAGACATCGTCCTTCATGTTGATCTTC
TCACCCTTGCCAGGGCCGGCGGCCGACTCTTCGCCTGCCTCGACCGCCCTCTTGCTCACGATGCGGTAAATCTGTTTCAAGACCTCCGCAAACGCGTCCT
CCACATTGGTCGACTCGAGCGCAGAGGTCTCCATGAAATAGAGTGACTCCCTCTCTGCAAACGACTTCCCTTCGTCGGTTGGGACTGCCACGAGATGGCG
GAGATCGGACTTGTTGCCAACAAGCATGACAACTATGTTCGGATCTGTATGGTCCCTCAATTCCTTCAGCCAGCGCTCTGCATTCTCGAAGGTTGCGTGC
CGAGTGACGTCGTAGACGAGCAACGCTCCTACAGCACCACGGTAGTATGCGCTAGTAATAGCACGGTATCGTTCCTGGCCAGCGGTGTCCCAAATCTGGG
CCTTGACGACCTTGCCGTCGACCTGGAGGGAGCGGGTGGCGAACTCGACCCCGATGGTGGACTTGGACTCGAGGCTGAACTCGTTGCGGGTGAAGCGGGA
GAGCAGGTTGGACTTGCCGACGCCGGAGTCGCCGATGAGGACGACCTTGAAGAGGTAGTCGTAGTCGTCCTCCGCCCGGTACCCCGCCGCCATTGCTCCC
GTCGCGTCGGCGATCTGGTTGTGGGGGGTGGCGAAGGAGGAGAGCGAGGGGGGAAGGGGAAGGTGGGGGAGGTG
page-top