Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36884  (registered. 2012)
Contig Information
Length 1284 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_SP 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218200284|gb|EEC82711.1|| hypothetical protein OsI_27383 [Oryza sativa Indica Group]
Score 553
Evalue 1.00E-155
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36884
CCTCGCCTCCACCACCGCCGCCGCTAGCTCGTCTCCCAGCCGCCGGCCGAGCTTAACCTCATTCCCGTCGCCGCTCCACCGACCAAGCGCGCTGTTCCAG
CAGACTAACTTCGTTGCCACTCGTACAGAGAGGAAGCCCGCACCTTCAGTGGCCGCCGCAGCGGCGTCGCCGGTATCACCCCTGCACAGGCTCGAGGAAA
TGAGTGACCATGAGGCAATCCCCGAAAGGCTCGCTGTGGTTACTGGTGGAAACAGAGGGATCGGCATAGAGGTGTGCCGCCAGCTTGCTCTCCAAGGTGT
GACGGTCATTCTCACAGCAAGGGATGAGGAAAGAGGAAAGGCTGCGGTTGAGTCCCTTTGCCGTGAATCTAACCTCTCCAACATAATCTTCCATCAGCTC
GATATACTGGATGCTGGTAGTCGTGCCTCATTAGCGCGACATATCGAGACCAGATATGGGAAGCTCGACATTTTGGTGAACAATGCAGGTGTTGGAGGGG
TGGCAGTAGACCAGGAAGGCCTGAGAGCTCTCAACATTGATCCTAAGATGTGGCTATCGGGGAAAGCAGCCCATCTGGTCGAATCGGTGATTATACAAAC
ATATGACGAGGCAGTAAAATGTCTTAACACCAACTACTATGGACTGAAATGGGCAACAGAAGCTCTCCTTCCGCTACTGAAGAAATCCACATCAGGAGCA
AGGATCATCAACACCTCCTCCCTTCGTTCAGAGCTGCAGAGAATGCCGAATGAGAAGCTGCGGGAGTCCCTGCGTGACGCCGACAGCTGGGACGAGGCGC
GGATTGAGGCCATGCTGAGCGAGTTCCTGGAGGACATGAAGAACGGGCGGCTGGAGGCGGCCGGGTGGCCGATGATGCTGCCGGCCTACAGCATGTCCAA
GATGGTGGTGAACCTCTACACCCGTATCCTGGCGAGGCGGCACCCAGAGATGCGCATCAACTGCGTGCACCCTGGGTTCGTCAAGACGGAGATCAACTGG
AACACGGGGGTCCTCCCGCCGGAGGAAGGCGCGAGGGGCGCGGTGATGCTGGCGCTGGCGCCCGGCGACGGGCCCACTGGCTGCTACTTCGATCAGACGA
AGATGGGGGAGGCTTGGTGATCGATGGTTACACGAAGGGTGCCACTTTGTTTAGGTTTGCTTTTTTCCACGCTTCAGACCTTCAGTTTAGATGTTTCTTA
GCTAGGCTGGTCCAGCAAACATGATTATCATTCGCCGCATTGTGAAACGCGGCTGCAATAATAAGAGGTCTCAGCTTAGATGTT
page-top