Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36878  (registered. 2012)
Contig Information
Length 1657 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115449487|ref|NP_001048478.1|| Os02g0812400 [Oryza sativa (japonica cultivar-group)]
Score 678
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36878
CAGGCGACGCTCTCCGCGTCATGTACGGCCGTGGCCTTATAAATGGTGACTTCGTTCTCATCAGCGGTGACACAATCAGCAACATGAGCTTAAAAGAGGT
TCTCCAGGAACACAAGGACAGAAGGAAAAAAGACCCACTTGCTGTTATGACTATGATTATAAAGCATTCAAAACCTTCAATCCTGATGCACCAGACACGT
TTGGGCACTGATGAAATTGTTATGGCGCTAGCATCTGAGACAAAGGAGCTACTTTATTATGAGGATAGGGCAGATAGCTCACACCTGTGCGTGACAATTG
ATAAGGATATACTGGCCAATAATCCTACTCTCCAGCTGCATAATAACATGGAGGATTGCTATATTGATATCTGCTCGCCAGACGTCCTTAGTCTTTTTAC
CGATAACTTTGACTANCAACATCTCCGGCGTCATTGTGAAGGGTTTACTTGTTGACGATATTATGGGATACAAAATCTATACTCATGAAATACACTCCAG
CTATGCTGCAAGAATAGATAATTTCAGGAGTTATGATGCTGTGAGCAAAGATATAATACAAAGATGGACATACCCTATGGTGCCTGATGTGTTATCCTTT
GGTAACTGCCATGAAATGAAACTTCACCGCCAAGGAATTTACAAGGCATCAGATGTAACATTGTCGCATTCTGCACAAATTGGTGCGAATTCTGTTATTG
GCAATGCAACAAGTATTGGAGAGCAGTGCAAGATATCGAATTCGGTAATTGGGGAAGGTTGCAGTATTGGGAAAAACGTTCTCATTCACGGTTCCTATAT
ATGGGATAATGTCATAATTGAAGATGGATGCAAAGTGAGTAACTCCTTAGTCTGCGATGATGTGCATCTAAGGGCAGGGGCAATTGTTGAGCCTGGCTGC
ATATTGTCGTTTAAGATTAAAGTTGGAAAGAATGTTGTTGTTCCTGCCTATTCAAAAGTGTCACTACTTGATAAGCCTTCAAATGAAGATAGTGATGAGG
AACTTGAGTATGCTGACACCAATTCTGGAGTTACAGATAGTGCACCCTTTTCCAGCACGAGGAGTAATGCCAACCACCCTACCATCGTATCCGAAGATGA
TGACTTAGGGGCATCTGAGACTGGTACCTCTGGTGTCCTTGGTTACATATGGGCAAGTGGTGATGCTGGAATTCAGGAGGAGTGGAGACAATCAATTGCT
CCAATTCCTAAAGAAAAACTTCAAGAGTTGCAGCATGCAGTTTCTGTTGACGGTGATGTTGGATCGGAAGAAGACTTGAACAACTGTCCATCTGAAGCAG
ACCGTGACAATGATTCTGAGATTGGTGTGATTGAGGATGATGATTATACTAAGTTTGAGAAAGAGGTCGAAGAGACTTTCCAACGGGCAGTTGATGGGGT
TCATCAAGATAATTTGATACTAGAAATCAACGCGCTCAGGTTGTCTTATAGCCTTCAACATGCAGATTGTGCTGGAGCAGTTTTCTATTCGATAATGAGG
GCTGCATTAGTCGCTGCACAATCTACCAATGATAGTCTTCTAAAGTCAACTGCGGACGCACTTACCAAGTGGAAGGATCTTCTACGCAATTNCACCAAGA
CAGTTGATGAGGAGATGGAAATACNNNTGAAGTTCGAGGAAATGTGTCAAGAGATAA
page-top