Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36858  (registered. 2012)
Contig Information
Length 616 bp
Clones alternative view 23 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 4
WH_SP 2
WH_XA Root 2
WH_XB Root 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|122022|sp|P27807.3|H2B1_WHEAT|H2B1_WHEAT RecName: Full=Histone H2B.1
Score 285
Evalue 3.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36858
ATATTACTTGCAGATAACCAGAGTCCACAGACAAGCACTAAACCAACAGGAAGGAACTGCATTTGCTACTAGATACAGGCGACGCAATCTAAGAGGAGGT
GAACTTGGTGACGGCCTTGGTGCCCTCAGAGACGGCGTGCTTGGCGAGCTCCCCGGGGAGGACGAGGCGGACGGAGGTCTGGATCTCCCGGGAGGTGATG
GTGGGCTTCTTGTTGTAGCGGGCGAGCTTGGAGGCCTCCCCGGCGAGCTTCTCGAAGATGTCGTTGATGAAGGAGTTCATGATGGACATGGCCTTGGAGG
AGATGCCGATGTCGGGGTGCACCTGCTTCAGCACCTTGAAGATGTAGATTTTGTAGGTCTCGACGCTCTTCTTGCTCTTCTTCTTGCCCTTCTTCTCGCC
GCCCTCCTTGGAGGCGGTCTTGCCGGCTGGCAGCCGCTTCTCGGCCTTGGGCTTCTTCGCCGCCGGGGCCTTCTCGGCCTTCTCCGCCGCGGGCTCCTCC
TCCGCGGGCTTCTTCGCCGCCGGCTTCTTCTCCGCCTTGGGGGCCATCGCTGCTTCGGGAGGGAGAGAAGGGTGGGTGGGTTGCTTCGCCGCCGGAAGGT
GTTGGGATCCTCGTGC
page-top