Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36816  (registered. 2012)
Contig Information
Length 619 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 2
Wh_yd Spikelet at late flowering 2
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_VABA Shoot with ABA treatment 1
WH_SP 4
WH_XB Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|122044864|sp|P05621.2|H2B2_WHEAT|H2B2_WHEAT RecName: Full=Histone H2B.2
Score 285
Evalue 2.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36816
CTTCAGTTCTCACAACCAACCAGCCAACGAAGCGTTGGCGACCACTCCTACCACTACTTGCAGATACGTAAGCAGAGTCAGCGACCACTAACAGGAGACA
ACAGCAGCCAACTACATCTGTCGCAACAAGCGACGCGACATCAGTCTAGGAGGATGTGAACTTGGTGACGGCCTTGGTGCCCTCGGAGACGGCGTGCTTG
GCGAGCTCGCCGGGGAGCACGAGGCGGACGGAGGTCTGGATCTCCCGGGAGGTGATGGTGGGCTTCTTGTTGTACCTCGCGAGCTTGGCGGACTCGCCGG
CGAGCTTCTCGAAGATGTCGTTGATGAAGGAGTTCATGATGGACATGGCCTTGGAGGAGATGCCGATGTCGGGGTGGACCTGCTTCAGCACCTTGAAGAT
GTAGATCTTGTACGTCTCCACGCCCTTCTTGGCCTTGCTGCCCTTCTTCCTGCCCCGGGTCTTCCCCTCGCCGCCGGCCTCCTTGGACGCCGTCTTGCCC
GCCGGCAGCCGCTTCTCGGCCTTGGGCTTCTTGCCCGCGGGGGTCTTCTCCGCCGCCTTCTCGACCTTGTTCTCGGCGACGGGCTTCTTGTCTGCCTTGG
GGGCCATGGCTGCCGCTTC
page-top