Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36814  (registered. 2012)
Contig Information
Length 692 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 1
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242092324|ref|XP_002436652.1|| hypothetical protein SORBIDRAFT_10g006620 [Sorghum bicolor]
Score 235
Evalue 3.00E-60
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36814
GCCCTCGCGCCGCCGCACCCCGCACCAACCAGCGCCCAGCCGCCGCCGGAGAAGGAGACGGAGCAGCCGCAGCCATGGGTCGCGTCCGCACCAAGACCGT
GAAGAAGACCTCCCGCCAGGTCATCGAGAAGTACTACTCTCGGATGACCCTCGACTTCCACACCAACAAGAAGGTGCTCGAGGAGGTCTCCATCCTCCAG
TCGAAGCGCCTCCGCAACAAGGTGGCCGGCTTCACCACCCATCTGATGCGCCGCATCCAGCGCGGCCCCGTGCGCGGCATCTCCCTCAAGCTGCAGGAGG
AGGAGCGTGAGCGCCGCATGGACTTCGTGCCGGAGAAGTCGGCGCTCGAGGTCGACGAGATCCGCGTCGACAAGGAGACCATGGACATGCTGGCGTTCCT
CGGCATGGCCGACCTCCCCGGCGTTGAGCGCGCCCCCGAGGCCACCTCTGCCGCTGCGCCCTACCGCCAGCCCTTCAACGGACCCCGCGGTGGCAATCGC
GCCTAGGTTCCTCCGCATCGTCGTCGTCGTACCCCTATCATCTTTACATGTTTTATTATTAGATNTGTTACTTGTGGCAAGTGATGTTTTGAACTCAGAG
CTTAAGTTCGAGGTATTTTGATCTGCGTATGGTGAACATGATCTGTTTATCTCATCGTTTATCTGAAGTGATTCGATATATTAAAAAAAAAA
page-top