Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36801  (registered. 2012)
Contig Information
Length 787 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|253721993|gb|ACT34062.1|| vacuolar ATP synthetase subunit C [Aegilops tauschii]
Score 510
Evalue 6.00E-143
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36801
GCGACGCGGTACTGGATCGCCGCGCTCCCCGTCGCCGACGACAACGTCGCCGCCGGCAAGACGGCCCTCTGGGGGCGCCTCCAGGACGCCATCTCCCGCC
ACTCCTTCGACACCCCGCTCTACCGCTTCACCGTCCCGGATCTCCGCCCCGGCACGCTCGACTCCCTGCTCGCCCTCAGCGACGACCTCGTCAAGTCCAA
CATCTTCATCGAGGGCGTCTCGCACAAGATCCGCCGGCAGATCGAGGACCTGGAGCGCGCCGGAGGGGTCGAGCCCGGCACCCTCACCGTCGACGGCGTC
CCCGTCGACAGCTACCTCACCAGGTTCGTGTGGGACGAGGGCAAGTACCCCGTCAACGCCCCGCTCAAGGAGACCGTCGCCAGCATCCAGTCCCAGGTCG
CCAAGATCGAGGACGACATGAAGGTTAGAGTTGCTGAATACGGTAATGTTAAGAGCCAGCTTGGCGCAATCAACAGGAAGCAAACTGGAAGTTTAGCAGT
TCGTGACCTTTCCAACCTCATAAAACCAGAGGATATGGTCACCTCGGAACATCTAGTGACACTGCTTTCTATTGTGCCAAAGTATTCCCAAAAAGACTGG
TTATCAAGCTACGAGTCACTTGATACGTTTGTGGTTCCGAGATCGTCAAAAAAGCTTTACGAGGACAATGAGTATGCTCTCTACACTGTAACATTATTTG
CCAAGGTTGTTGACAACTTNNNNNNCCATGCTCGTGAGAAAGGTTTCCAGATCCGTGACTTTGAGTATAGTCCTGAAGCACAGGAGA
page-top