Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36754  (registered. 2012)
Contig Information
Length 756 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_yd Spikelet at late flowering 5
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 1
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 2
WH_XC Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115479853|ref|NP_001063520.1|| Os09g0485900 [Oryza sativa (japonica cultivar-group)]
Score 332
Evalue 3.00E-89
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36754
CGCCCCCTCCCCCGCCGCCGCCGCCGCCGCCAAGCAACCAGCCCCCAGCACCCATCACCGGCCGGCGAAGATGAAGACGATCCTGGCGTCGGAGACGATG
GAGATCCCGGAGGAGGTGACGGTGAAGGTGTCGGCGAAGATGATCTCGGTGACGGGTCCCCGGGGCACGCTGACCCGCAACTTCAAGCACCTCAACCTCG
ACTTCCAGCTGCAGGAGGGCGGGCGGAGGCTCAAGGTGGACGCCTGGTTCGGCACCCGCAAGACCATGGCCGCCATCCGCACCGCCATCTCCCACGTCCA
GAACCTCATCACGGGGGTCACCAAGGGCTTCCGCTACAAGATGCGCTTCGTGTATGCTCACTTCCCCATCAACGCCTCCATCACCGCCGCCAACCGCGGC
ATCGAGATCAGGAACTTCCTCGGCGAGAAGAAGGTGAGGAAGGTGGACATGCTCGACGGGGTCACCATCCTGCGGTCCGAGAAGGTCAAGGACGAGATCG
TCCTCGACGGCAACGACATCGAGCTCGTCTCCCGCTCCGCCGCCCTCATCAACCAGAAATGCCATGTCAAGAACAAGGATATCAGGAAGTTCTTGGACGG
CATCTACGTCAGCGACAAGGGCGCCATCAAGGANNNGTAGAGAGCCGGAAACCGTCCCGCCCACCAGNNNCCGTGTTTCTGCCTGCCGTGTTTGTTTCAT
CGTGTTTGTGTCTGTCTGTCGTCGTCGTCTTCGTGATTTTGAACTTTCTCTAGACT
page-top