Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36650  (registered. 2012)
Contig Information
Length 876 bp
Clones alternative view 28 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 4
Wh_yd Spikelet at late flowering 11
Wh_CSEC Callus 2
Wh_OKCS Seed DPA5 7
Wh_RDr Root of dessiccated seed 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115482036|ref|NP_001064611.1|| Os10g0418000 [Oryza sativa (japonica cultivar-group)]
Score 259
Evalue 2.00E-67
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36650
AATCTAACAAAACGTCCAGCCAGCAGGCAGTCCAGTTGCAGTGATCTCAAGCGAAACCAACAAAAATAAAAAAGTTAAACCTGAATATCCATGAAGACGA
ATAGCAAGGGTTGTCTAGTCTTCAGGAAACCAAATATGAGCAGTTCCATATCACGATTACATTTGCCAAGTCTTTACCTAATAACAAGTTACCGAAAGCT
AGCCCAATCACAAATTCAGACAACCTATTCAGGTTGTGATAATAGCAACACGTAACAGATAGCACAACATAACAAGGGATCACGAAGATACAACACACAA
CAACTACCCGTTATTGCATTTCATTCACTCCTTGGAGGTCTTGTTGATGAGTGACTTGTGGATGTGAGGGATGACACCACCACCAGCGATGGTGCCCTTG
ATGAGGGTGTCCAGCTCCTCATCTCCACGGATCGCAAGCTGCAGGTGGCGAGGGGTGATACGCTTCACCTTGAGATCCTTGCTAGCGTTGCCGGCCAGCT
CAAGGACCTCGGCAGTAAGGTACTCAAGGATTGCTGCAGAGTACACAGCAGCAGTGGCACCCACACGGCCATTAGCCGAGACCCTCTGCTTGAGCTGCCT
GTGTATACGTCCCACCGGGAACTGAATCCCGGCGCGGGAGGAGCGGGACACGGGCGCCTTCTTCTTGTCCTTGTCCTTGTCGGCGGCGCCCTTGGCCGCC
GTCGTCTTCGCCGCAAGCAGCCCCTTGCCTCCTTTCCCGGCCATCTCCCTTTGCAGCAGAGCCTCCTACCTGGCTTCCTCTCGCCTCTCTCTGTGGAGCA
GCTACAGGGCTGAGAACTGACTGGGGCTTGGGTGCTTCCCTCGTGCCATGGAATATTGAGCCACCTTGCAAGGTTA
page-top