Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36558  (registered. 2012)
Contig Information
Length 1144 bp
Clones alternative view 48 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 9
Wh_dL Crown of seedling 8
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 6
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_SP 1
WH_XA Root 1
WH_XB Root 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242049786|ref|XP_002462637.1|| hypothetical protein SORBIDRAFT_02g029380 [Sorghum bicolor]
Score 493
Evalue 1.00E-137
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36558
GGAATTCGGCACGAGGCCCCCCTCCACCTCCTCCCCCAGCGTCGCCTCCCGTTCGGAACCCCAAGCTCCCCCCGCCGCCGGCGAAATGGCCCCGAAGCGA
GGCGGCAAGGCGCCGGTGCCGGCGAAGAAGAAGGCGGCGGACAAGGTGGTGAACCCACTGTTCGAGAAGAGGCCGAAGCAGTTCGGCATCGGCGGGGCGC
TGCCGCCCAAGAAGGACCTCCACCGGTTCGTCAAGTGGCCCAAGGTCGTGCGGATCCAGCGCCAGCGCCGCATCCTCAAGCAGCGCCTCAAGGTTCCCCC
GGCGCTCCACCAGTTCACCCGCACCCTCGACAAGAACCTCGCCACCAACCTGTTTAAGATGCTTCTCAAGTACCGCCCCGAGGACAAGGTGGCTAAGAAG
GAGAGGCTTCTGAAGAGGGCCCAGGCTGAGGCTGAGGGGAAAACCGTTGAGGCCAAGAAGCCAATTGTTGTCAAGTATGGTCTTAACCATGTCACTTACC
TCATCGAGCAGAGCAAGGCTCAGCTGGTCGTCATCGCTCATGATGTTGACCCAATTGAGCTGGTTGTGTGGCTCCCAGCCCTGTGCAGGAAGATGGAGGT
TCCATACTGCATTGTTAAGGGAAAATCACGCCTTGGATCGATCGTTCACAAGAAGACTGCCTCAGTTCTGTGCCTCACCACTGTGAAGAACGAGGACAAG
CTTGAGTTCAGCAAGATCTTGGAGGCTATCAAGGCTAACTTCAACGACAAGTTTGACGAGGTCAGGAAGAAGTGGGGCGGTGGTGTCATGGGATCCAAGT
CGCAGGCCAAGACCAAGGCCAGGGAAAGGCTCATCGCCAAGGAGGCTGCGCAGAGGATGAACTAAGCCTAGCCTTATATGCGAGAGCATATGCCATGTAG
TTTCCCTTTCAGTGTGTCCTGATTTTGACGAGGAACTCGAACCCTTTTAGCAGCACTGTGGAATCGTATTGTGGTTTTCTGATTCTCTGTTCCGTTCTCC
AGACTTATGCAAAGATCAGATGAGGTTTACCCATGTTTGGATTCTATATAGTTTTATGTCCTTTGTTGAGTTTGACATCTTCCTAACTTGGCTAGGTTTT
GGTTAACATGCAATGACGACGAGCTCAATCTGTTTGTGAATTTG
page-top