Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36552  (registered. 2012)
Contig Information
Length 1250 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 2
Wh_RDr Root of dessiccated seed 1
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XN Leaves, plant was grown at constant 23℃ 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218190179|gb|EEC72606.1|| hypothetical protein OsI_06079 [Oryza sativa Indica Group]
Score 504
Evalue 1.00E-140
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36552
CACCATCTTCTACAGTAATATTCTGCACAAATTAAGCTAAACGGAAACAAGCTAAACAAGAATTTATGTTGAAATTAAACAAGGAAGCAAGTCGACATTT
TTTTTTACAAGGTAGCAGAGCTACTCGCTGTAGATTTACAGAAAACTAGTTCCAATGGCAATCACGACGAATATGTGAGAACCAAAGAACTAGTTCGCAG
CAACAGCAGCTGGTATTTGAGATTTCAACAGTAACATCTAATGGCGAGCACACGCCAAAATCTTAATCCTCCAGCTCAACAATCTGCGCCCTTCTCTCGG
CAGCTTTCTTCCTGACAAATATTCCCCATCTCATAGCAGCCTTTATCTTGAGCCACCCGACAACGGCTTTGCCCGATGGACGGCTGGGCTCACCTTCAGA
GTCTGGGTTTGGGAATGGAGATGGAATGTCAGGGAAGGAAAATGTTTCGTCTGGCAAACCAGTAGAAGCTCCGCCCATATTGAAGATCCTGAGCAGCTGC
TGCATGTCGTCACCCTCGAGCAGTTGGTGGCTTTTCATGCGAATGTCTTCAGTGAAATCATCAGCATACTGACCATCACGGTTGTGATGCCAATTATCGT
AGCCGACGTTTGCTGGCTGAATTGGTTGACGTTGAGAAATTGTGTGATGCAACTGGCCGAGTTCCAGACCCATGCCATCAGTTGCTGTTCCCTGATTAGA
CCCCATCAACATGGTAGGCGGCAAAAATGAAAAGGCGTCGTCATATGGCACAGGCACATTAGCAGATGAACTCTGAAGCTGAACAGACTGTGTTGCTGTC
TGGTTGCCATCATACCCTATAGAACCATTTGTGCCTGTTGTAGATGGTCCTGGCATACTCGTTGAAGAAATGCACTGTACATATGCAGCAGGAGCACGAG
CCTCAGCTTGATTAGTTAATGCAGCCTTTTTCTTCGGTTTAGGGTTCAAGAGAGCTTTGCCATCATATTCAATAACATACATCCAATTATCATATGCTTT
CTTCACCAGCCCATCAGCAAAATGCTTTTGGCCATCATCAAGACTCTCAGACGAATAGAATTGCTCGCCAGAAATCAGCCCACAGAATGCATAGAGGTCG
TTGAAAATAGCACCAGCAGTTCTGTTCTCATCAGAATAGTATATGTAATATTTTCCACTCAAGACACAGGTTTTTGCATGTTCAACGAGGGAATCCCACA
TCTTGTTNGACATGCCACTTCCGAGGATAGTACGCAGCTTCTGTGCCTCG
page-top